AGK Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

AGK Polyclonal Antibody
ABP57726-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410 Applications tips:
Description: A polyclonal antibody for detection of AGK from Human, Mouse. This AGK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410

AGK Polyclonal Antibody
ES9068-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against AGK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AGK Polyclonal Antibody
ES9068-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against AGK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Acylglycerol Kinase (AGK) ELISA Kit
DLR-AGK-Hu-48T	DL Develop	48T	EUR 517
Should the Human Acylglycerol Kinase (AGK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acylglycerol Kinase (AGK) in samples from tissue homogenates or other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit
DLR-AGK-Hu-96T	DL Develop	96T	EUR 673
Should the Human Acylglycerol Kinase (AGK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acylglycerol Kinase (AGK) in samples from tissue homogenates or other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit
RD-AGK-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Acylglycerol Kinase (AGK) ELISA Kit
RD-AGK-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Acylglycerol Kinase (AGK) ELISA Kit
RDR-AGK-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Acylglycerol Kinase (AGK) ELISA Kit
RDR-AGK-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

AGK Rabbit pAb
A9976-100ul	Abclonal	100 ul	EUR 308

AGK Rabbit pAb
A9976-200ul	Abclonal	200 ul	EUR 459

AGK Rabbit pAb
A9976-20ul	Abclonal	20 ul	EUR 183

AGK Rabbit pAb
A9976-50ul	Abclonal	50 ul	EUR 223

AGK Antibody
45528-100ul	SAB	100ul	EUR 252

AGK Antibody
45528-50ul	SAB	50ul	EUR 187

AGK Antibody
1-CSB-PA706634LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

AGK Antibody
DF8835	Affbiotech	200ul	EUR 304
Description: AGK Antibody detects endogenous levels of total AGK.

AGK antibody
70R-3532	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal AGK antibody raised against the N terminal of AGK

AGK antibody
70R-9479	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal AGK antibody

AGK Antibody
ABD8835	Lifescience Market	100 ug	EUR 438

AGK Monoclonal Antibody
29784-100ul	SAB	100ul	EUR 252

AGK Monoclonal Antibody
29784-50ul	SAB	50ul	EUR 187

AGK Conjugated Antibody
C45528	SAB	100ul	EUR 397

Anti-AGK antibody
STJ112017	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10.

Anti-AGK antibody
STJ118682	St John's Laboratory	100 µl	EUR 393

Anti-AGK antibody
STJ190226	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to AGK

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse)
4-PAG236Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AGK (Thr15~Pro300) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK)

AGK 2
B7323-10	ApexBio	10 mg	EUR 273
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation.

AGK 2
B7323-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 247
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation.

AGK 2
B7323-50	ApexBio	50 mg	EUR 986
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation.

AGK siRNA
20-abx906999	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AGK siRNA
20-abx907000	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pENTR223- AGK
PVT10006	Lifescience Market	2 ug	EUR 266

pCDNA3.1- AGK
PVT10259	Lifescience Market	2 ug	EUR 301

AGK Antibody, HRP conjugated
1-CSB-PA706634LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AGK Antibody, FITC conjugated
1-CSB-PA706634LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AGK Antibody, Biotin conjugated
1-CSB-PA706634LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Acylglycerol Kinase (AGK) Antibody
abx036608-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Acylglycerol Kinase (AGK) Antibody
20-abx131353	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Acylglycerol Kinase (AGK) Antibody
20-abx135896	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Acylglycerol Kinase (AGK) Antibody
20-abx148048	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Acylglycerol Kinase (AGK) Antibody
20-abx171072	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

AGK Monoclonal Conjugated Antibody
C29784	SAB	100ul	EUR 397

Acylglycerol Kinase (AGK) Antibody
abx432131-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), APC
4-PAG236Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AGK (Thr15~Pro300) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with APC.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAG236Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AGK (Thr15~Pro300) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with Biotin.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), Cy3
4-PAG236Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AGK (Thr15~Pro300) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with Cy3.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), FITC
4-PAG236Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AGK (Thr15~Pro300) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with FITC.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), HRP
4-PAG236Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AGK (Thr15~Pro300) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with HRP.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), PE
4-PAG236Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AGK (Thr15~Pro300) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with PE.

Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E04A1324-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E04A1324-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E04A1324-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AGK Mouse mAb
A16230-100ul	Abclonal	100 ul	EUR 384

AGK Mouse mAb
A16230-200ul	Abclonal	200 ul	EUR 554

AGK Mouse mAb
A16230-20ul	Abclonal	20 ul	EUR 183

AGK Mouse mAb
A16230-50ul	Abclonal	50 ul	EUR 265

AGK Blocking Peptide
33R-2085	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGK antibody, catalog no. 70R-9479

AGK Blocking Peptide
33R-4482	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGK antibody, catalog no. 70R-3532

AGK Blocking Peptide
DF8835-BP	Affbiotech	1mg	EUR 195

AGK cloning plasmid
CSB-CL706634HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 198 Sequence: atgacggtgttctttaaaacgcttcgaaatcactggaagaaaactacagctgggctctgcctgctgacctggggaggccattggctctatggaaaacactgtgataacctcctaaggagagcagcctgtcaagaagctcagcactatcaggatgaatcacgctgggagccaactct Show more
Description: A cloning plasmid for the AGK gene.

AGK cloning plasmid
CSB-CL706634HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1269 Sequence: atgacggtgttctttaaaacgcttcgaaatcactggaagaaaactacagctgggctctgcctgctgacctggggaggccattggctctatggaaaacactgtgataacctcctaaggagagcagcctgtcaagaagctcaggtgtttggcaatcaactcattcctcccaatgcac Show more
Description: A cloning plasmid for the AGK gene.

pT7- His- AGK
PVT10121	Lifescience Market	2 ug	EUR 301

pDONR223- AGK Plasmid
PVT7100	Lifescience Market	2 ug	EUR 266

Acylglycerol Kinase, Mitochondrial (AGK) Antibody
20-abx317853	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAG236Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AGK (Thr15~Pro300) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with APC-Cy7.

Acylglycerol Kinase, Mitochondrial (AGK) Antibody (HRP)
20-abx314524	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Acylglycerol Kinase, Mitochondrial (AGK) Antibody (FITC)
20-abx314525	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Acylglycerol Kinase, Mitochondrial (AGK) Antibody (Biotin)
20-abx314526	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse AGK shRNA Plasmid
20-abx977092	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human AGK shRNA Plasmid
20-abx960887	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Acylglycerol Kinase (AGK)
4-RPG236Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q53H12 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 61.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Acylglycerol Kinase expressed in: E.coli

AGK Recombinant Protein (Human)
RP000730	ABM	100 ug	Ask for price

AGK Recombinant Protein (Human)
RP000733	ABM	100 ug	Ask for price

AGK Recombinant Protein (Mouse)
RP114779	ABM	100 ug	Ask for price

AGK Recombinant Protein (Rat)
RP189512	ABM	100 ug	Ask for price

Human Acylglycerol Kinase (AGK) Protein
20-abx650682	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Agk ORF Vector (Rat) (pORF)
ORF063172	ABM	1.0 ug DNA	EUR 506

AGK ORF Vector (Human) (pORF)
ORF000244	ABM	1.0 ug DNA	EUR 95

AGK ORF Vector (Human) (pORF)
ORF000245	ABM	1.0 ug DNA	EUR 95

Agk ORF Vector (Mouse) (pORF)
ORF038261	ABM	1.0 ug DNA	EUR 506

AGK ELISA Kit (Human) (OKCD00496)
OKCD00496	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Lipid kinase that can phosphorylate both monoacylglycerol and diacylglycerol to form lysophosphatidic acid (LPA) and phosphatidic acid (PA), respectively. Does not phosphorylate sphingosine. Overexpression increases the formation and secretion of LPA, resulting in transactivation of EGFR and activation of the downstream MAPK signaling pathway, leading to increased cell growth.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.6"A novel acylglycerol kinase that produces lysophosphatidic acid modulates cross talk with EGFR in prostate cancer cells."_x005F_x005F_x000D_Bektas M., Payne S.G., Liu H., Goparaju S., Milstien S., Spiegel S._x005F_x005F_x000D_J. Cell Biol. 169:801-811(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, COFACTOR, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.081 ng/mL

AGK ELISA Kit (Human) (OKDD00117)
OKDD00117	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.081 ng/mL

Human Acylglycerol Kinase (AGK) ELISA Kit
20-abx150540	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Acylglycerol Kinase (AGK) CLIA Kit
20-abx495134	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Agk sgRNA CRISPR Lentivector set (Rat)
K6147601	ABM	3 x 1.0 ug	EUR 339

AGK sgRNA CRISPR Lentivector set (Human)
K0058001	ABM	3 x 1.0 ug	EUR 339

Agk sgRNA CRISPR Lentivector set (Mouse)
K4699601	ABM	3 x 1.0 ug	EUR 339

Human Acylglycerol Kinase (AGK) ELISA Kit
SEG236Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit
SEG236Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit
SEG236Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit
SEG236Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit
4-SEG236Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Acylglycerol Kinase elisa. Alternative names of the recognized antigen: MULK Multiple Substrate Lipid Kinase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acylglycerol Kinase (AGK) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E01A1324-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E01A1324-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E01A1324-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E02A1324-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E02A1324-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E02A1324-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E06A1324-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E06A1324-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E06A1324-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E03A1324-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E03A1324-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E03A1324-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E07A1324-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E07A1324-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E07A1324-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E08A1324-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E08A1324-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E08A1324-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E09A1324-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E09A1324-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E09A1324-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acylglycerol kinase, mitochondrial, Agk ELISA KIT
ELI-11913m	Lifescience Market	96 Tests	EUR 865

Human Acylglycerol kinase, mitochondrial, AGK ELISA KIT
ELI-24573h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human AGK (Acylglycerol Kinase)
ELK3404	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Acylglycerol Kinase (AGK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Acylglyc Show more
Description: A sandwich ELISA kit for detection of Acylglycerol Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Agk sgRNA CRISPR Lentivector (Rat) (Target 1)
K6147602	ABM	1.0 ug DNA	EUR 154

Agk sgRNA CRISPR Lentivector (Rat) (Target 2)
K6147603	ABM	1.0 ug DNA	EUR 154

Agk sgRNA CRISPR Lentivector (Rat) (Target 3)
K6147604	ABM	1.0 ug DNA	EUR 154

AGK sgRNA CRISPR Lentivector (Human) (Target 1)
K0058002	ABM	1.0 ug DNA	EUR 154

AGK sgRNA CRISPR Lentivector (Human) (Target 2)
K0058003	ABM	1.0 ug DNA	EUR 154

AGK sgRNA CRISPR Lentivector (Human) (Target 3)
K0058004	ABM	1.0 ug DNA	EUR 154

Agk sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4699602	ABM	1.0 ug DNA	EUR 154

Agk sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4699603	ABM	1.0 ug DNA	EUR 154

Agk sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4699604	ABM	1.0 ug DNA	EUR 154

AGK Protein Vector (Mouse) (pPB-C-His)
PV153042	ABM	500 ng	EUR 603

AGK Protein Vector (Mouse) (pPB-N-His)
PV153043	ABM	500 ng	EUR 603

AGK Protein Vector (Mouse) (pPM-C-HA)
PV153044	ABM	500 ng	EUR 603

AGK Protein Vector (Mouse) (pPM-C-His)
PV153045	ABM	500 ng	EUR 603

AGK Protein Vector (Rat) (pPB-C-His)
PV252686	ABM	500 ng	EUR 603

AGK Protein Vector (Rat) (pPB-N-His)
PV252687	ABM	500 ng	EUR 603

AGK Protein Vector (Rat) (pPM-C-HA)
PV252688	ABM	500 ng	EUR 603

AGK Protein Vector (Rat) (pPM-C-His)
PV252689	ABM	500 ng	EUR 603

AGK Protein Vector (Human) (pPB-His-MBP)
PV320494	ABM	500 ng	EUR 329