AGK Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

AGK Polyclonal Antibody

ABP57726-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of AGK from Human, Mouse. This AGK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410

AGK Polyclonal Antibody

ES9068-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AGK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AGK Polyclonal Antibody

ES9068-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AGK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Acylglycerol Kinase (AGK) ELISA Kit

DLR-AGK-Hu-48T 48T
EUR 517
  • Should the Human Acylglycerol Kinase (AGK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acylglycerol Kinase (AGK) in samples from tissue homogenates or other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit

DLR-AGK-Hu-96T 96T
EUR 673
  • Should the Human Acylglycerol Kinase (AGK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acylglycerol Kinase (AGK) in samples from tissue homogenates or other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit

RD-AGK-Hu-48Tests 48 Tests
EUR 521

Human Acylglycerol Kinase (AGK) ELISA Kit

RD-AGK-Hu-96Tests 96 Tests
EUR 723

Human Acylglycerol Kinase (AGK) ELISA Kit

RDR-AGK-Hu-48Tests 48 Tests
EUR 544

Human Acylglycerol Kinase (AGK) ELISA Kit

RDR-AGK-Hu-96Tests 96 Tests
EUR 756

AGK Rabbit pAb

A9976-100ul 100 ul
EUR 308

AGK Rabbit pAb

A9976-200ul 200 ul
EUR 459

AGK Rabbit pAb

A9976-20ul 20 ul
EUR 183

AGK Rabbit pAb

A9976-50ul 50 ul
EUR 223

AGK Antibody

45528-100ul 100ul
EUR 252

AGK Antibody

45528-50ul 50ul
EUR 187

AGK Antibody

1-CSB-PA706634LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

AGK Antibody

DF8835 200ul
EUR 304
Description: AGK Antibody detects endogenous levels of total AGK.

AGK antibody

70R-3532 50 ug
EUR 467
Description: Rabbit polyclonal AGK antibody raised against the N terminal of AGK

AGK antibody

70R-9479 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal AGK antibody

AGK Antibody

ABD8835 100 ug
EUR 438

AGK Monoclonal Antibody

29784-100ul 100ul
EUR 252

AGK Monoclonal Antibody

29784-50ul 50ul
EUR 187

AGK Conjugated Antibody

C45528 100ul
EUR 397

Anti-AGK antibody

STJ112017 100 µl
EUR 277
Description: The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10.

Anti-AGK antibody

STJ118682 100 µl
EUR 393

Anti-AGK antibody

STJ190226 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AGK

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse)

4-PAG236Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK)

AGK 2

B7323-10 10 mg
EUR 273
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation.

AGK 2

B7323-5.1 10 mM (in 1mL DMSO)
EUR 247
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation.

AGK 2

B7323-50 50 mg
EUR 986
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation.

AGK siRNA

20-abx906999
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AGK siRNA

20-abx907000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223- AGK

PVT10006 2 ug
EUR 266

pCDNA3.1- AGK

PVT10259 2 ug
EUR 301

AGK Antibody, HRP conjugated

1-CSB-PA706634LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AGK Antibody, FITC conjugated

1-CSB-PA706634LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AGK Antibody, Biotin conjugated

1-CSB-PA706634LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Acylglycerol Kinase (AGK) Antibody

abx036608-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Acylglycerol Kinase (AGK) Antibody

20-abx131353
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Acylglycerol Kinase (AGK) Antibody

20-abx135896
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Acylglycerol Kinase (AGK) Antibody

20-abx148048
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acylglycerol Kinase (AGK) Antibody

20-abx171072
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

AGK Monoclonal Conjugated Antibody

C29784 100ul
EUR 397

Acylglycerol Kinase (AGK) Antibody

abx432131-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), APC

4-PAG236Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with APC.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAG236Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with Biotin.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), Cy3

4-PAG236Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with Cy3.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), FITC

4-PAG236Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with FITC.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), HRP

4-PAG236Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with HRP.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), PE

4-PAG236Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with PE.

Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E04A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E04A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E04A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AGK Mouse mAb

A16230-100ul 100 ul
EUR 384

AGK Mouse mAb

A16230-200ul 200 ul
EUR 554

AGK Mouse mAb

A16230-20ul 20 ul
EUR 183

AGK Mouse mAb

A16230-50ul 50 ul
EUR 265

AGK Blocking Peptide

33R-2085 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGK antibody, catalog no. 70R-9479

AGK Blocking Peptide

33R-4482 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGK antibody, catalog no. 70R-3532

AGK Blocking Peptide

DF8835-BP 1mg
EUR 195

AGK cloning plasmid

CSB-CL706634HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 198
  • Sequence: atgacggtgttctttaaaacgcttcgaaatcactggaagaaaactacagctgggctctgcctgctgacctggggaggccattggctctatggaaaacactgtgataacctcctaaggagagcagcctgtcaagaagctcagcactatcaggatgaatcacgctgggagccaactct
  • Show more
Description: A cloning plasmid for the AGK gene.

AGK cloning plasmid

CSB-CL706634HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1269
  • Sequence: atgacggtgttctttaaaacgcttcgaaatcactggaagaaaactacagctgggctctgcctgctgacctggggaggccattggctctatggaaaacactgtgataacctcctaaggagagcagcctgtcaagaagctcaggtgtttggcaatcaactcattcctcccaatgcac
  • Show more
Description: A cloning plasmid for the AGK gene.

pT7- His- AGK

PVT10121 2 ug
EUR 301

pDONR223- AGK Plasmid

PVT7100 2 ug
EUR 266

Acylglycerol Kinase, Mitochondrial (AGK) Antibody

20-abx317853
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAG236Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with APC-Cy7.

Acylglycerol Kinase, Mitochondrial (AGK) Antibody (HRP)

20-abx314524
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acylglycerol Kinase, Mitochondrial (AGK) Antibody (FITC)

20-abx314525
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acylglycerol Kinase, Mitochondrial (AGK) Antibody (Biotin)

20-abx314526
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse AGK shRNA Plasmid

20-abx977092
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AGK shRNA Plasmid

20-abx960887
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Acylglycerol Kinase (AGK)

4-RPG236Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q53H12
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 61.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Acylglycerol Kinase expressed in: E.coli

AGK Recombinant Protein (Human)

RP000730 100 ug Ask for price

AGK Recombinant Protein (Human)

RP000733 100 ug Ask for price

AGK Recombinant Protein (Mouse)

RP114779 100 ug Ask for price

AGK Recombinant Protein (Rat)

RP189512 100 ug Ask for price

Human Acylglycerol Kinase (AGK) Protein

20-abx650682
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Agk ORF Vector (Rat) (pORF)

ORF063172 1.0 ug DNA
EUR 506

AGK ORF Vector (Human) (pORF)

ORF000244 1.0 ug DNA
EUR 95

AGK ORF Vector (Human) (pORF)

ORF000245 1.0 ug DNA
EUR 95

Agk ORF Vector (Mouse) (pORF)

ORF038261 1.0 ug DNA
EUR 506

AGK ELISA Kit (Human) (OKCD00496)

OKCD00496 96 Wells
EUR 831
Description: Description of target: Lipid kinase that can phosphorylate both monoacylglycerol and diacylglycerol to form lysophosphatidic acid (LPA) and phosphatidic acid (PA), respectively. Does not phosphorylate sphingosine. Overexpression increases the formation and secretion of LPA, resulting in transactivation of EGFR and activation of the downstream MAPK signaling pathway, leading to increased cell growth.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.6"A novel acylglycerol kinase that produces lysophosphatidic acid modulates cross talk with EGFR in prostate cancer cells."_x005F_x005F_x000D_Bektas M., Payne S.G., Liu H., Goparaju S., Milstien S., Spiegel S._x005F_x005F_x000D_J. Cell Biol. 169:801-811(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, COFACTOR, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.081 ng/mL

AGK ELISA Kit (Human) (OKDD00117)

OKDD00117 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.081 ng/mL

Human Acylglycerol Kinase (AGK) ELISA Kit

20-abx150540
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Acylglycerol Kinase (AGK) CLIA Kit

20-abx495134
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Agk sgRNA CRISPR Lentivector set (Rat)

K6147601 3 x 1.0 ug
EUR 339

AGK sgRNA CRISPR Lentivector set (Human)

K0058001 3 x 1.0 ug
EUR 339

Agk sgRNA CRISPR Lentivector set (Mouse)

K4699601 3 x 1.0 ug
EUR 339

Human Acylglycerol Kinase (AGK) ELISA Kit

SEG236Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit

SEG236Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit

SEG236Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit

SEG236Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.

Human Acylglycerol Kinase (AGK) ELISA Kit

4-SEG236Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Acylglycerol Kinase elisa. Alternative names of the recognized antigen: MULK
  • Multiple Substrate Lipid Kinase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acylglycerol Kinase (AGK) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E01A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E01A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E01A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E02A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E02A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E02A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E06A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E06A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E06A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E03A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E03A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E03A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E07A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E07A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E07A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E08A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E08A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E08A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E09A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E09A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit

E09A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acylglycerol kinase, mitochondrial, Agk ELISA KIT

ELI-11913m 96 Tests
EUR 865

Human Acylglycerol kinase, mitochondrial, AGK ELISA KIT

ELI-24573h 96 Tests
EUR 824

ELISA kit for Human AGK (Acylglycerol Kinase)

ELK3404 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Acylglycerol Kinase (AGK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Acylglyc
  • Show more
Description: A sandwich ELISA kit for detection of Acylglycerol Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Agk sgRNA CRISPR Lentivector (Rat) (Target 1)

K6147602 1.0 ug DNA
EUR 154

Agk sgRNA CRISPR Lentivector (Rat) (Target 2)

K6147603 1.0 ug DNA
EUR 154

Agk sgRNA CRISPR Lentivector (Rat) (Target 3)

K6147604 1.0 ug DNA
EUR 154

AGK sgRNA CRISPR Lentivector (Human) (Target 1)

K0058002 1.0 ug DNA
EUR 154

AGK sgRNA CRISPR Lentivector (Human) (Target 2)

K0058003 1.0 ug DNA
EUR 154

AGK sgRNA CRISPR Lentivector (Human) (Target 3)

K0058004 1.0 ug DNA
EUR 154

Agk sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4699602 1.0 ug DNA
EUR 154

Agk sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4699603 1.0 ug DNA
EUR 154

Agk sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4699604 1.0 ug DNA
EUR 154

AGK Protein Vector (Mouse) (pPB-C-His)

PV153042 500 ng
EUR 603

AGK Protein Vector (Mouse) (pPB-N-His)

PV153043 500 ng
EUR 603

AGK Protein Vector (Mouse) (pPM-C-HA)

PV153044 500 ng
EUR 603

AGK Protein Vector (Mouse) (pPM-C-His)

PV153045 500 ng
EUR 603

AGK Protein Vector (Rat) (pPB-C-His)

PV252686 500 ng
EUR 603

AGK Protein Vector (Rat) (pPB-N-His)

PV252687 500 ng
EUR 603

AGK Protein Vector (Rat) (pPM-C-HA)

PV252688 500 ng
EUR 603

AGK Protein Vector (Rat) (pPM-C-His)

PV252689 500 ng
EUR 603

AGK Protein Vector (Human) (pPB-His-MBP)

PV320494 500 ng
EUR 329

 

Scroll to Top