AGTR1 Rabbit Polyclonal Antibody

To Order:

AGTR1 Polyclonal Antibody

ES8937-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AGTR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AGTR1 Rabbit pAb

A1313-100ul 100 ul
EUR 308

AGTR1 Rabbit pAb

A1313-200ul 200 ul
EUR 459

AGTR1 Rabbit pAb

A1313-20ul 20 ul Ask for price

AGTR1 Rabbit pAb

A1313-50ul 50 ul Ask for price

AGTR1 Rabbit pAb

A14201-100ul 100 ul
EUR 308

AGTR1 Rabbit pAb

A14201-200ul 200 ul
EUR 459

AGTR1 Rabbit pAb

A14201-20ul 20 ul
EUR 183

AGTR1 Rabbit pAb

A14201-50ul 50 ul
EUR 223

Polyclonal AGTR1 Antibody (Center)

APG01614G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AGTR1 (Center). This antibody is tested and proven to work in the following applications:

Human Angiotensin II Receptor 1 (AGTR1) ELISA Kit

DLR-AGTR1-Hu-48T 48T
EUR 444
  • Should the Human Angiotensin II Receptor 1 (AGTR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiotensin II Receptor 1 (AGTR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Angiotensin II Receptor 1 (AGTR1) ELISA Kit

DLR-AGTR1-Hu-96T 96T
EUR 573
  • Should the Human Angiotensin II Receptor 1 (AGTR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiotensin II Receptor 1 (AGTR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Angiotensin II Receptor 1 (AGTR1) ELISA Kit

DLR-AGTR1-Ra-48T 48T
EUR 475
  • Should the Rat Angiotensin II Receptor 1 (AGTR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiotensin II Receptor 1 (AGTR1) in samples from tissue homogenates or other biological fluids.

Rat Angiotensin II Receptor 1 (AGTR1) ELISA Kit

DLR-AGTR1-Ra-96T 96T
EUR 616
  • Should the Rat Angiotensin II Receptor 1 (AGTR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiotensin II Receptor 1 (AGTR1) in samples from tissue homogenates or other biological fluids.

Human Angiotensin II Receptor 1 (AGTR1) ELISA Kit

RD-AGTR1-Hu-48Tests 48 Tests
EUR 439

Human Angiotensin II Receptor 1 (AGTR1) ELISA Kit

RD-AGTR1-Hu-96Tests 96 Tests
EUR 606

Rat Angiotensin II Receptor 1 (AGTR1) ELISA Kit

RD-AGTR1-Ra-48Tests 48 Tests
EUR 473

Rat Angiotensin II Receptor 1 (AGTR1) ELISA Kit

RD-AGTR1-Ra-96Tests 96 Tests
EUR 655

Human Angiotensin II Receptor 1 (AGTR1) ELISA Kit

RDR-AGTR1-Hu-48Tests 48 Tests
EUR 458

Human Angiotensin II Receptor 1 (AGTR1) ELISA Kit

RDR-AGTR1-Hu-96Tests 96 Tests
EUR 633

Rat Angiotensin II Receptor 1 (AGTR1) ELISA Kit

RDR-AGTR1-Ra-48Tests 48 Tests
EUR 495

Rat Angiotensin II Receptor 1 (AGTR1) ELISA Kit

RDR-AGTR1-Ra-96Tests 96 Tests
EUR 685

Anti-AGTR1 Rabbit Monoclonal Antibody

M01213 100ug/vial
EUR 397
Description: Rabbit Monoclonal AGTR1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Rabbit AGTR1 ELISA Kit

ERTA0502 96Tests
EUR 521

AGTR1 Antibody

24966-100ul 100ul
EUR 390

AGTR1 antibody

70R-31423 100 ug
EUR 327
Description: Rabbit polyclonal AGTR1 antibody

AGTR1 Antibody

EUR 387

AGTR1 Antibody

35616-100ul 100ul
EUR 252

AGTR1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGTR1. Recognizes AGTR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

AGTR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGTR1. Recognizes AGTR1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

AGTR1 Antibody

DF4910 200ul
EUR 304
Description: AGTR1 Antibody detects endogenous levels of total AGTR1.

AGTR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGTR1. Recognizes AGTR1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

AGTR1 antibody

70R-AC001 100 ug
EUR 640
Description: Affinity purified Chicken polyclonal AGTR1 antibody

AGTR1 antibody

70R-AR007 100 ug
EUR 640
Description: Affinity purified Rabbit polyclonal AGTR1 antibody

AGTR1 antibody

70R-5938 50 ug
EUR 467
Description: Rabbit polyclonal AGTR1 antibody raised against the N terminal of AGTR1

AGTR1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AGTR1. Recognizes AGTR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

AGTR1 Antibody

ABD4910 100 ug
EUR 438

Polyclonal Goat Anti-AGTR1 / AT1 Antibody

AMM04871G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AGTR1 / AT1 . This antibody is tested and proven to work in the following applications:

AGTR1 Conjugated Antibody

C35616 100ul
EUR 397

anti- AGTR1 antibody

FNab00222 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: angiotensin II receptor, type 1
  • Uniprot ID: P30556
  • Gene ID: 185
  • Research Area: Signal Transduction
Description: Antibody raised against AGTR1

Anti-AGTR1 antibody

PAab00222 100 ug
EUR 355

Anti-AGTR1 antibody

STJ111072 100 µl
EUR 277
Description: Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene.

Anti-AGTR1 antibody

STJ116133 100 µl
EUR 277
Description: Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene.

Anti-AGTR1 antibody

STJ99655 200 µl
EUR 197
Description: Rabbit polyclonal to AGTR1.

Agtr1/ Rat Agtr1 ELISA Kit

ELI-05429r 96 Tests
EUR 657


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AGTR1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGTR1. Recognizes AGTR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AGTR1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGTR1. Recognizes AGTR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AGTR1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGTR1. Recognizes AGTR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-AGTR1 / AT1 antibody

STJ71011 100 µg
EUR 359

Angiotensin II Receptor 1 (AGTR1) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGTR1 (Asp263~Glu359)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Angiotensin II Receptor 1 (AGTR1)

AGTR1 Blocking Peptide

33R-4056 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGTR1 antibody, catalog no. 70R-5938

AGTR1 Blocking Peptide

DF4910-BP 1mg
EUR 195

AGTR1 cloning plasmid

CSB-CL001465HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1080
  • Sequence: atgattctcaactcttctactgaagatggtattaaaagaatccaagatgattgtcccaaagctggaaggcataattacatatttgtcatgattcctactttatacagtatcatctttgtggtgggaatatttggaaacagcttggtggtgatagtcatttacttttatatgaagc
  • Show more
Description: A cloning plasmid for the AGTR1 gene.

AGTR1 cloning plasmid

CSB-CL001465HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1080
  • Sequence: atgattctcaactcttctactgaagatggtattaaaagaatccaagatgattgtcccaaagctggaaggcataattacatatttgtcatgattcctactttatacagtatcatctttgtggtgggaatatttggaaacagcttggtggtgatagtcatttacttttatatgaagc
  • Show more
Description: A cloning plasmid for the AGTR1 gene.

pBluescriptR-AGTR1 Plasmid

PVT17023 2 ug
EUR 325

Angiotensin II Receptor 1 (AGTR1) Polyclonal Antibody (Rat), APC

  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGTR1 (Asp263~Glu359)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Angiotensin II Receptor 1 (AGTR1). This antibody is labeled with APC.

Angiotensin II Receptor 1 (AGTR1) Polyclonal Antibody (Rat), Biotinylated

  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGTR1 (Asp263~Glu359)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Angiotensin II Receptor 1 (AGTR1). This antibody is labeled with Biotin.

Angiotensin II Receptor 1 (AGTR1) Polyclonal Antibody (Rat), Cy3

  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGTR1 (Asp263~Glu359)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Angiotensin II Receptor 1 (AGTR1). This antibody is labeled with Cy3.

Angiotensin II Receptor 1 (AGTR1) Polyclonal Antibody (Rat), FITC

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGTR1 (Asp263~Glu359)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Angiotensin II Receptor 1 (AGTR1). This antibody is labeled with FITC.

Angiotensin II Receptor 1 (AGTR1) Polyclonal Antibody (Rat), HRP

  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGTR1 (Asp263~Glu359)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Angiotensin II Receptor 1 (AGTR1). This antibody is labeled with HRP.

Angiotensin II Receptor 1 (AGTR1) Polyclonal Antibody (Rat), PE

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGTR1 (Asp263~Glu359)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Angiotensin II Receptor 1 (AGTR1). This antibody is labeled with PE.

Angiotensin II Receptor 1 (AGTR1) Antibody

  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Angiotensin II Receptor 1 (AGTR1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Angiotensin II Receptor 1 (AGTR1) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Angiotensin II Receptor 1 (AGTR1) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Angiotensin II Receptor 1 (AGTR1) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGTR1 (Asp263~Glu359)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Angiotensin II Receptor 1 (AGTR1). This antibody is labeled with APC-Cy7.


EHA0502 96Tests
EUR 521


ELA-E1658h 96 Tests
EUR 824


EGTA0502 96Tests
EUR 521

Canine AGTR1 ELISA Kit

ECA0502 96Tests
EUR 521

Chicken AGTR1 ELISA Kit

ECKA0502 96Tests
EUR 521

Anserini AGTR1 ELISA Kit

EAA0502 96Tests
EUR 521

Bovine AGTR1 ELISA Kit

EBA0502 96Tests
EUR 521


ELI-05432d 96 Tests
EUR 928


EF005992 96 Tests
EUR 689

Rat AGTR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AGTR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EMA0502 96Tests
EUR 521


ERA0502 96Tests
EUR 521


ESA0502 96Tests
EUR 521

Monkey AGTR1 ELISA Kit

EMKA0502 96Tests
EUR 521

Porcine AGTR1 ELISA Kit

EPA0502 96Tests
EUR 521

AGTR1 Recombinant Protein (Human)

RP000784 100 ug Ask for price

AGTR1 Recombinant Protein (Human)

RP000787 100 ug Ask for price


STJ150198 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of ANG II in Rat serum, plasma and other biological fluids


STJ150418 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of ANG I in Rat serum, plasma and other biological fluids


STJ150435 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of Ang-II in human serum, plasma and other biological fluids


STJ150529 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of Ang-I in human serum, plasma and other biological fluids

Rabbit Angiotensin II Receptor Type 1 Antibody (AGTR1-Ab) ELISA Kit

abx362944-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Type- 1 angiotensin II receptor, AGTR1 ELISA KIT

ELI-05426Ra 96 Tests
EUR 928

Rabbit Angiotensin II Receptor Type 1 (AGTR1) ELISA Kit

abx363693-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody

abx037681-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody

abx148059-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Type-1 angiotensin II receptor (AGTR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Type-1 angiotensin II receptor (AGTR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Type-1 angiotensin II receptor (AGTR1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody

abx430326-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody

abx230222-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Guinea Pig AGTR1 ELISA Kit

EGA0502 96Tests
EUR 521

AGTR1 ORF Vector (Human) (pORF)

ORF000262 1.0 ug DNA
EUR 95

AGTR1 ORF Vector (Human) (pORF)

ORF000263 1.0 ug DNA
EUR 95

AGTR1 ELISA Kit (Human) (OKAN06596)

OKAN06596 96 Wells
EUR 792
Description: Description of target: Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

AGTR1 ELISA Kit (Rat) (OKCA00946)

OKCA00946 96 Wells
EUR 917
Description: Description of target: Receptor for angiotensin II. Mediates its action by association with G proteins that activate a phosphatidylinositol-calcium second messenger system. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 19.5 pg/mL

AGTR1 ELISA Kit (Human) (OKCD07560)

OKCD07560 96 Wells
EUR 936
Description: Description of target: Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. AGTR1 is the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. AGTR1 may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans.Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. At least five transcript variants have been described for this gene. Additional variants have been described but their full-length nature has not been determined. The entire coding sequence is contained in the terminal exon and is present in all transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

AGTR1 ELISA Kit (Human) (OKEH04681)

OKEH04681 96 Wells
EUR 662
Description: Description of target: Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.94 ng/mL

Angiotensin II Receptor Type 1 (AGTR1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiotensin II Receptor Type 1 (AGTR1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Angiotensin II Type 1 Receptor/AGTR1 Antibody

PB9470 100ug/vial
EUR 334

AGTR1 sgRNA CRISPR Lentivector set (Human)

K0059901 3 x 1.0 ug
EUR 339

Recombinant Angiotensin II Receptor 1 (AGTR1)

  • EUR 288.16
  • EUR 180.00
  • EUR 805.60
  • EUR 335.20
  • EUR 570.40
  • EUR 256.00
  • EUR 1864.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P30556
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Angiotensin II Receptor 1 expressed in: E.coli

Recombinant Angiotensin II Receptor 1 (AGTR1)

  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P25095
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Angiotensin II Receptor 1 expressed in: E.coli

Human Type-1 angiotensin II receptor (AGTR1)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 9.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Type-1 angiotensin II receptor(AGTR1),partial expressed in Yeast

Rat Angiotensin II Receptor 1 (AGTR1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Angiotensin II Receptor 1 (AGTR1) Protein

  • EUR 411.00
  • EUR 217.00
  • EUR 1107.00
  • EUR 481.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

AGTR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0059902 1.0 ug DNA
EUR 154

AGTR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0059903 1.0 ug DNA
EUR 154

AGTR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0059904 1.0 ug DNA
EUR 154

AGTR1 Protein Vector (Human) (pPB-His-MBP)

PV320610 500 ng
EUR 329

AGTR1 Protein Vector (Human) (pPB-His-GST)

PV320611 500 ng
EUR 329

AGTR1 Protein Vector (Human) (pPB-C-His)

PV001045 500 ng
EUR 329

AGTR1 Protein Vector (Human) (pPB-N-His)

PV001046 500 ng
EUR 329

AGTR1 Protein Vector (Human) (pPM-C-HA)

PV001047 500 ng
EUR 329

AGTR1 Protein Vector (Human) (pPM-C-His)

PV001048 500 ng
EUR 329

AGTR1 Protein Vector (Human) (pPB-C-His)

PV001049 500 ng
EUR 329

AGTR1 Protein Vector (Human) (pPB-N-His)

PV001050 500 ng
EUR 329

AGTR1 Protein Vector (Human) (pPM-C-HA)

PV001051 500 ng
EUR 329

AGTR1 Protein Vector (Human) (pPM-C-His)

PV001052 500 ng
EUR 329

AGTR1 3'UTR GFP Stable Cell Line

TU050487 1.0 ml
EUR 1394

AGTR1 3'UTR Luciferase Stable Cell Line

TU000487 1.0 ml
EUR 1394

AGTR1 ELISA Kit (Rat) : 96 Wells (OKEH01197)

OKEH01197 96 Wells
EUR 662
Description: Description of target: receptor for and mediator of vascular remodeling effects of angiotensin II ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.63 ng/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40


Scroll to Top