AKAP9 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

AKAP9 Polyclonal Antibody

ES9089-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AKAP9 from Human. This antibody is tested and validated for IHC

AKAP9 antibody

20R-1204 100 ug
EUR 377
Description: Rabbit polyclonal AKAP9 antibody

AKAP9 Antibody

36069-100ul 100ul
EUR 252

AKAP9 Antibody

1-CSB-PA857882LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AKAP9. Recognizes AKAP9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

AKAP9 Antibody

DF8864 200ul
EUR 304
Description: AKAP9 Antibody detects endogenous levels of total AKAP9.

AKAP9 Antibody

1-CSB-PA280169
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AKAP9. Recognizes AKAP9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

Akap9 antibody

70R-8419 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Akap9 antibody

AKAP9 Antibody

ABD8864 100 ug
EUR 438

AKAP9 Conjugated Antibody

C36069 100ul
EUR 397

Anti-AKAP9 antibody

STJ190247 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AKAP9

AKAP9 siRNA

20-abx907159
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AKAP9 siRNA

20-abx907160
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AKAP9 Antibody, HRP conjugated

1-CSB-PA857882LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AKAP9. Recognizes AKAP9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AKAP9 Antibody, FITC conjugated

1-CSB-PA857882LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AKAP9. Recognizes AKAP9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AKAP9 Antibody, Biotin conjugated

1-CSB-PA857882LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AKAP9. Recognizes AKAP9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-AKAP9 / YOTIAO antibody

STJ71845 100 µg
EUR 260

Akap9 Blocking Peptide

33R-2477 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Akap9 antibody, catalog no. 70R-8419

AKAP9 Blocking Peptide

33R-5898 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AKAP9 antibody, catalog no. 20R-1204

AKAP9 Blocking Peptide

DF8864-BP 1mg
EUR 195

AKAP9 cloning plasmid

CSB-CL857882HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 945
  • Sequence: atggaggacgaggagagacagaagaagctggaggccggcaaagccaagcttgcccagtttcgacaaagaaaagctcagtcggatgggcagagtccttccaagaagcagaaaaaaaagagaaaaacgtcaagcagtaaacatgatgtgtcagcacaccatgatttgaatattgatca
  • Show more
Description: A cloning plasmid for the AKAP9 gene.

Anti-AKAP9 (1A6)

YF-MA17152 50 ug
EUR 363
Description: Mouse monoclonal to AKAP9

Anti-AKAP9 (7E12)

YF-MA20486 100 ug
EUR 363
Description: Mouse monoclonal to AKAP9

Human AKAP9 shRNA Plasmid

20-abx956843
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AKAP9 shRNA Plasmid

20-abx979471
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-AKAP9 / AKAP450 / CG-NAP antibody

STJ70660 100 µg
EUR 359

Rabbit A kinase anchor protein 9(AKAP9) ELISA kit

E04A1363-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A kinase anchor protein 9(AKAP9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A kinase anchor protein 9(AKAP9) ELISA kit

E04A1363-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A kinase anchor protein 9(AKAP9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A kinase anchor protein 9(AKAP9) ELISA kit

E04A1363-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A kinase anchor protein 9(AKAP9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A- kinase anchor protein 9, AKAP9 ELISA KIT

ELI-34679Ra 96 Tests
EUR 928

A-Kinase Anchoring Protein 9 (AKAP9) Antibody

20-abx339100
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

A-Kinase Anchor Protein 9 (AKAP9) Antibody

abx430479-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

A-Kinase Anchor Protein 9 (AKAP9) Antibody

abx430480-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

A-Kinase Anchor Protein 9 (AKAP9) Antibody

20-abx302596
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Akap9 ORF Vector (Rat) (pORF)

ORF063246 1.0 ug DNA
EUR 4070

AKAP9 ORF Vector (Human) (pORF)

ORF000298 1.0 ug DNA
EUR 95

Akap9 ORF Vector (Mouse) (pORF)

ORF038395 1.0 ug DNA
EUR 4078

A-Kinase Anchoring Protein 9 (AKAP9) Antibody (HRP)

20-abx316495
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

A-Kinase Anchoring Protein 9 (AKAP9) Antibody (FITC)

20-abx316496
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

A-Kinase Anchoring Protein 9 (AKAP9) Antibody (Biotin)

20-abx316497
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Akap9 sgRNA CRISPR Lentivector set (Rat)

K7547101 3 x 1.0 ug
EUR 339

AKAP9 sgRNA CRISPR Lentivector set (Human)

K0066301 3 x 1.0 ug
EUR 339

Akap9 sgRNA CRISPR Lentivector set (Mouse)

K3501001 3 x 1.0 ug
EUR 339

Akap9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7547102 1.0 ug DNA
EUR 154

Akap9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7547103 1.0 ug DNA
EUR 154

Akap9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7547104 1.0 ug DNA
EUR 154

AKAP9 sgRNA CRISPR Lentivector (Human) (Target 1)

K0066302 1.0 ug DNA
EUR 154

AKAP9 sgRNA CRISPR Lentivector (Human) (Target 2)

K0066303 1.0 ug DNA
EUR 154

AKAP9 sgRNA CRISPR Lentivector (Human) (Target 3)

K0066304 1.0 ug DNA
EUR 154

Akap9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3501002 1.0 ug DNA
EUR 154

Akap9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3501003 1.0 ug DNA
EUR 154

Akap9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3501004 1.0 ug DNA
EUR 154

AKAP9 Protein Vector (Mouse) (pPB-C-His)

PV153578 500 ng
EUR 6008

AKAP9 Protein Vector (Mouse) (pPB-N-His)

PV153579 500 ng
EUR 6008

AKAP9 Protein Vector (Mouse) (pPM-C-HA)

PV153580 500 ng
EUR 6008

AKAP9 Protein Vector (Mouse) (pPM-C-His)

PV153581 500 ng
EUR 6008

AKAP9 Protein Vector (Rat) (pPB-C-His)

PV252982 500 ng
EUR 5995

AKAP9 Protein Vector (Rat) (pPB-N-His)

PV252983 500 ng
EUR 5995

AKAP9 Protein Vector (Rat) (pPM-C-HA)

PV252984 500 ng
EUR 5995

AKAP9 Protein Vector (Rat) (pPM-C-His)

PV252985 500 ng
EUR 5995

AKAP9 Protein Vector (Human) (pPB-His-MBP)

PV320954 500 ng
EUR 329

AKAP9 Protein Vector (Human) (pPB-His-GST)

PV320955 500 ng
EUR 329

AKAP9 Protein Vector (Human) (pPB-C-His)

PV001189 500 ng
EUR 329

AKAP9 Protein Vector (Human) (pPB-N-His)

PV001190 500 ng
EUR 329

AKAP9 Protein Vector (Human) (pPM-C-HA)

PV001191 500 ng
EUR 329

AKAP9 Protein Vector (Human) (pPM-C-His)

PV001192 500 ng
EUR 329

Akap9 3'UTR Luciferase Stable Cell Line

TU101623 1.0 ml Ask for price

Akap9 3'UTR GFP Stable Cell Line

TU151623 1.0 ml Ask for price

Akap9 3'UTR Luciferase Stable Cell Line

TU200462 1.0 ml Ask for price

Akap9 3'UTR GFP Stable Cell Line

TU250462 1.0 ml Ask for price

AKAP9 3'UTR GFP Stable Cell Line

TU050553 1.0 ml
EUR 2333

AKAP9 3'UTR Luciferase Stable Cell Line

TU000553 1.0 ml
EUR 2333

AKAP9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV638923 1.0 ug DNA
EUR 5532

AKAP9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV638927 1.0 ug DNA
EUR 5532

AKAP9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV638928 1.0 ug DNA
EUR 5532

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

 

Scroll to Top