AVP Receptor V3 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

AVP Receptor V3 Polyclonal Antibody

ABP57860-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human, Mouse, Rat. This AVP Receptor V3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320

AVP Receptor V3 Polyclonal Antibody

ABP57860-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human, Mouse, Rat. This AVP Receptor V3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320

AVP Receptor V3 Polyclonal Antibody

ABP57860-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human, Mouse, Rat. This AVP Receptor V3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320

AVP Receptor V3 Polyclonal Antibody

ABP50738-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human. This AVP Receptor V3 antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330

AVP Receptor V3 Polyclonal Antibody

ABP50738-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human. This AVP Receptor V3 antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330

AVP Receptor V3 Polyclonal Antibody

ABP50738-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human. This AVP Receptor V3 antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330

AVP Receptor V3 Polyclonal Antibody

46878-100ul 100ul
EUR 252

AVP Receptor V3 Polyclonal Antibody

46878-50ul 50ul
EUR 187

AVP Receptor V3 Polyclonal Conjugated Antibody

C46878 100ul
EUR 397

Anti-AVP Receptor V3 antibody

STJ91789 200 µl
EUR 197
Description: Rabbit polyclonal to AVP Receptor V3.

Anti-AVP Receptor V3 antibody

STJ98822 200 µl
EUR 197
Description: Rabbit polyclonal to AVP Receptor V3.

Vasopressin V3 Receptor Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

AVP Receptor V2 Polyclonal Antibody

ES6726-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AVP Receptor V2 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

AVP Receptor V2 Polyclonal Antibody

ES6726-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AVP Receptor V2 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

AVP Receptor V2 Polyclonal Antibody

ES8846-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AVP Receptor V2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AVP Receptor V2 Polyclonal Antibody

ES8846-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AVP Receptor V2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AVP Receptor V2 Polyclonal Antibody

ABP55727-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human. This AVP Receptor V2 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120

AVP Receptor V2 Polyclonal Antibody

ABP55727-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human. This AVP Receptor V2 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120

AVP Receptor V2 Polyclonal Antibody

ABP55727-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human. This AVP Receptor V2 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120

AVP Receptor V2 Polyclonal Antibody

ABP57859-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V2 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human, Mouse. This AVP Receptor V2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V2 protein at amino acid sequence of 1-50

AVP Receptor V2 Polyclonal Antibody

ABP57859-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V2 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human, Mouse. This AVP Receptor V2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V2 protein at amino acid sequence of 1-50

AVP Receptor V2 Polyclonal Antibody

ABP57859-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V2 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human, Mouse. This AVP Receptor V2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V2 protein at amino acid sequence of 1-50

AVP Receptor V2 Polyclonal Antibody

46898-100ul 100ul
EUR 252

AVP Receptor V2 Polyclonal Antibody

46898-50ul 50ul
EUR 187

AVP Receptor V2 Polyclonal Conjugated Antibody

C46898 100ul
EUR 397

AVP Polyclonal Antibody

A54862 100 µg
EUR 570.55
Description: fast delivery possible

Vasopressin V3 Receptor Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

AVP Rabbit pAb

A1725-100ul 100 ul
EUR 308

AVP Rabbit pAb

A1725-200ul 200 ul
EUR 459

AVP Rabbit pAb

A1725-20ul 20 ul
EUR 183

AVP Rabbit pAb

A1725-50ul 50 ul
EUR 223

Polyclonal AVP Antibody (Center)

APG03184G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AVP (Center). This antibody is tested and proven to work in the following applications:

Anti-AVP Receptor V2 antibody

STJ91788 200 µl
EUR 197
Description: Rabbit polyclonal to AVP Receptor V2.

Anti-AVP Receptor V2 antibody

STJ99319 200 µl
EUR 197
Description: Rabbit polyclonal to AVP Receptor V2.

Rabbit AVP ELISA Kit

ERTA0909 96Tests
EUR 521

AVP Polyclonal Antibody, Biotin Conjugated

A57843 100 µg
EUR 570.55
Description: fast delivery possible

AVP Polyclonal Antibody, FITC Conjugated

A57844 100 µg
EUR 570.55
Description: reagents widely cited

AVP Polyclonal Antibody, HRP Conjugated

A54861 100 µg
EUR 570.55
Description: reagents widely cited

AVP Antibody

47965-100ul 100ul
EUR 252

AVP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AVP. Recognizes AVP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

AVP Conjugated Antibody

C47965 100ul
EUR 397

Anti-AVP antibody

STJ400041 1 mg
EUR 446
Description: Copeptin is a 39-amino acid glycopeptide, cleaved from the C-terminus of pre- provasopressin (pre-proAVP). It has been suggested as a biomarker in diagnosis and prognosis of several diseases, such as acute myocardial infarction, heart failure, hyponatremia, and sepsis.

Anti-AVP antibody

STJ400042 1 mg
EUR 446
Description: Copeptin is a 39-amino acid glycopeptide, cleaved from the C-terminus of pre- provasopressin (pre-proAVP). It has been suggested as a biomarker in diagnosis and prognosis of several diseases, such as acute myocardial infarction, heart failure, hyponatremia, and sepsis.

Anti-AVP antibody

STJ400043 1 mg
EUR 446
Description: Copeptin is a 39-amino acid glycopeptide, cleaved from the C-terminus of pre- provasopressin (pre-proAVP). It has been suggested as a biomarker in diagnosis and prognosis of several diseases, such as acute myocardial infarction, heart failure, hyponatremia, and sepsis.

Anti-AVP antibody

STJ400044 1 mg
EUR 446
Description: Copeptin is a 39-amino acid glycopeptide, cleaved from the C-terminus of pre- provasopressin (pre-proAVP). It has been suggested as a biomarker in diagnosis and prognosis of several diseases, such as acute myocardial infarction, heart failure, hyponatremia, and sepsis.

Anti-AVP antibody

STJ117784 100 µl
EUR 277
Description: This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin is a posterior pituitary hormone that is synthesized in the supraoptic nucleus and paraventricular nucleus of the hypothalamus. Along with its carrier protein, neurophysin 2, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis where it is either stored or secreted into the bloodstream. The precursor is thought to be activated while it is being transported along the axon to the posterior pituitary. Arginine vasopressin acts as a growth factor by enhancing pH regulation through acid-base transport systems. It has a direct antidiuretic action on the kidney, and also causes vasoconstriction of the peripheral vessels. This hormone can contract smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. Mutations in this gene cause autosomal dominant neurohypophyseal diabetes insipidus (ADNDI). This gene is present in a gene cluster with the related gene oxytocin on chromosome 20.

Rabbit Arginine vasopressin, AVP ELISA Kit

CELI-66041Rb 96 Tests
EUR 928

Rabbit Anti-Rat AVP V1b Antiserum

AVP1B13-S 100 ul
EUR 457

Rabbit Anti-Rat AVP-V2 Antiserum

AVPV21-S 100 ul
EUR 457


ERTA0745 96Tests
EUR 521

Rabbit arginine vasopressin (AVP) ELISA kit

CSB-EL002466RB-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit arginine vasopressin (AVP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rabbit arginine vasopressin (AVP) ELISA kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit arginine vasopressin (AVP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Arginine Vasopressin (AVP) Antibody

abx411676-50ul 50 ul
EUR 439
  • Shipped within 1 week.

Arginine Vasopressin (AVP) Antibody

abx412424-01ml 0.1 ml
EUR 578
  • Shipped within 1 week.

AVP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AVP. Recognizes AVP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AVP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AVP. Recognizes AVP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AVP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AVP. Recognizes AVP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rabbit Anti-Rat AVP V1a Antiserum #1

AVP1A11-S 100 ul
EUR 457

Rabbit Anti-Rat AVP V1a Antiserum #2

AVP1A12-S 100 ul
EUR 457

Mugwort Allergen Act v3 Protein

abx061539-05mg 0.5 mg
EUR 1080
  • Shipped within 5-10 working days.

Recombinant Mugwort Art v3. [His]

DAGA-3100 0.5 mg
EUR 1300

CMV-Null control Adenovirus

AVP-Null 1x109 IFU/ml x 200ul
EUR 349
Description: Pre-made Null-control Adenovirus , provided in DMEM medium.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody

abx122677-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody

abx330362-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody

abx235637-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


B5382-1 1 mg
EUR 535

Human AVP Protein

30-1960 50 ug
EUR 259
Description: Recombinant Human Vasopressin-neurophysin 2-copeptin(AVP)

AVP cloning plasmid

CSB-CL002466HU-10ug 10ug
EUR 248
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 495
  • Sequence: atgcctgacaccatgctgcccgcctgcttcctcggcctactggccttctcctccgcgtgctacttccagaactgcccgaggggcggcaagagggccatgtccgacctggagctgagacagtgcctcccctgcggccccgggggcaaaggccgctgcttcgggcccagcatctgctg
  • Show more
Description: A cloning plasmid for the AVP gene.

Glucocorticoid receptor/GR Rabbit Polyclonal Antibody

38045-100ul 100ul
EUR 252

Glucocorticoid receptor/GR Rabbit Polyclonal Antibody

38045-50ul 50ul
EUR 187

Rabbit Anti-Rat AVP V1b IgG, aff pure

AVP1B13-A 100 ug
EUR 482

Rabbit Anti-Rat AVP-V2 IgG, aff pure

AVPV21-A 100 ug
EUR 482

Cluster of Differentiation 44 Exon V3 (CD44v3) Antibody

abx413297-01mg 0.1 mg
EUR 439
  • Shipped within 1 week.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TruePrep Index Kit V3 for Illumina

TD203 384 rxn
EUR 766

Vasopressin-Neurophysin 2-Copeptin (AVP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucocorticoid receptor/GR Rabbit Polyclonal Conjugated Antibody

C38045 100ul
EUR 397

Rabbit Anti Human Egf Receptor Polyclonal Antibody

CPBT-65686RH 50 µg
EUR 819

Rabbit Anti Human Tslp Receptor Polyclonal Antibody

CPBT-65709RH 0.1 mg
EUR 580

Rabbit Anti Human Androgen Receptor Polyclonal Antibody

CPBT-65817RH 1 ml
EUR 767

Rabbit Anti Rat Calcitonin Receptor Polyclonal Antibody

CPBT-65945RR 0.1 mg
EUR 892

Rat AVP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E0365h 96 Tests
EUR 824


EHA0909 96Tests
EUR 521


EGTA0909 96Tests
EUR 521

Canine AVP ELISA Kit

ECA0909 96Tests
EUR 521

Bovine AVP ELISA Kit

EBA0909 96Tests
EUR 521

Anserini AVP ELISA Kit

EAA0909 96Tests
EUR 521


EF000569 96 Tests
EUR 689


ERA0909 96Tests
EUR 521

Porcine AVP ELISA Kit

EPA0909 96Tests
EUR 521


EMA0909 96Tests
EUR 521

Human AVP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


55R-1951 96 tests
EUR 617
Description: ELISA Kit for detection of AVP in the research laboratory

Mouse AVP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AVP Recombinant Protein (Human)

RP036880 100 ug Ask for price

AVP Recombinant Protein (Rat)

RP191654 100 ug Ask for price

AVP Recombinant Protein (Mouse)

RP118325 100 ug Ask for price

Rabbit Anti-Rat AVP V1a IgG #1, aff pure

AVP1A11-A 100 ug
EUR 482

Rabbit Anti-Rat AVP V1a IgG #2, aff pure

AVP1A12-A 100 ug
EUR 482

HIV-1 gp120 V3 loop region Protein

abx060582-1mg 1 mg
EUR 1094
  • Shipped within 5-10 working days.

Vasopressin-neurophysin 2-copeptin (AVP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vasopressin-neurophysin 2-copeptin (AVP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vasopressin-neurophysin 2-copeptin (AVP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit Anti Human Interleukin-21 Receptor Polyclonal Antibody

CPBT-65693RH 0.1 mg
EUR 710

Rabbit Anti Human Muscarinic Receptor M3 Polyclonal Antibody

CPBT-66730RH 50 µg
EUR 985

Rabbit Anti Rat Nmda Receptor Nr2a Polyclonal Antibody

CPBT-66734RR 10 µg
EUR 1375

Rabbit Anti Rat Nmda Receptor Nr2b Polyclonal Antibody

CPBT-66738RR 10 µg
EUR 1375

Interleukin 1 Receptor Antagonist (IL1RA) Polyclonal Antibody (Rabbit)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg26~Gln177
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Guinea polyclonal antibody against Rabbit Interleukin 1 Receptor Antagonist (IL1RA)

Cluster of Differentiation 44 Exons V3-V10 (CD44v3-v10) Antibody

abx411980-1mg 1 mg
EUR 704
  • Shipped within 1 week.

Arginine Vasopressin (AVP) ELISA Kit

abx556290-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Guinea Pig AVP ELISA Kit

EGA0909 96Tests
EUR 521

Avp ORF Vector (Mouse) (pORF)

ORF039443 1.0 ug DNA
EUR 506

AVP ORF Vector (Human) (pORF)

ORF012294 1.0 ug DNA
EUR 354

Avp ORF Vector (Rat) (pORF)

ORF063886 1.0 ug DNA
EUR 506

AVP ELISA Kit (Mouse) (OKCD00196)

OKCD00196 96 Wells
EUR 857
Description: Description of target: This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin binds to vasopressin receptors and functions as a vasopressor, to constrict blood vessels and increase blood pressure, and as an antidiuretic, to reduce the production of urine. Neurophysin 2 functions as a carrier protein in the transport of arginine vasopressin. This gene is present in a gene cluster with the related gene oxytocin on chromosome 2.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 5.7 pg/mL

AVP ELISA Kit (Rat) (OKAN05173)

OKAN05173 96 Wells
EUR 792
Description: Description of target: neuropeptide hormone; involved in vasoconstriction to regulate blood pressure and smooth muscle contraction during parturition and lactation [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL

AVP ELISA Kit (Mouse) (OKAN06450)

OKAN06450 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin binds to vasopressin receptors and functions as a vasopressor, to constrict blood vessels and increase blood pressure, and as an antidiuretic, to reduce the production of urine. Neurophysin 2 functions as a carrier protein in the transport of arginine vasopressin. This gene is present in a gene cluster with the related gene oxytocin on chromosome 2.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

AVP ELISA Kit (Human) (OKCD06266)

OKCD06266 96 Wells
EUR 805
Description: Description of target: This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin is a posterior pituitary hormone that is synthesized in the supraoptic nucleus and paraventricular nucleus of the hypothalamus. Along with its carrier protein, neurophysin 2, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis where it is either stored or secreted into the bloodstream. The precursor is thought to be activated while it is being transported along the axon to the posterior pituitary. Arginine vasopressin acts as a growth factor by enhancing pH regulation through acid-base transport systems. It has a direct antidiuretic action on the kidney, and also causes vasoconstriction of the peripheral vessels. This hormone can contract smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. Mutations in this gene cause autosomal dominant neurohypophyseal diabetes insipidus (ADNDI). This gene is present in a gene cluster with the related gene oxytocin on chromosome 20.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL

AVP ELISA Kit (Rat) (OKCD06267)

OKCD06267 96 Wells
EUR 818
Description: Description of target: Neuropeptide hormone; involved in vasoconstriction to regulate blood pressure and smooth muscle contraction during parturition and lactation.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 5.9 pg/mL

AVP ELISA Kit (Rat) (OKCD08532)

OKCD08532 96 Wells
EUR 1053
Description: Description of target: neuropeptide hormone; involved in vasoconstriction to regulate blood pressure and smooth muscle contraction during parturition and lactation.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL

AVP ELISA Kit (Rat) (OKEH03099)

OKEH03099 96 Wells
EUR 740
Description: Description of target: Neurophysin 2 specifically binds vasopressin. Vasopressin has a direct antidiuretic action on the kidney, it also causes vasoconstriction of the peripheral vessels.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.78 pg/mL

AVP ELISA Kit (Sheep) (OKCA01026)

OKCA01026 96 Wells
EUR 917
Description: Description of target: Neurophysin 2 specifically binds vasopressin. Vasopressin has a direct antidiuretic action on the kidney, it also causes vasoconstriction of the peripheral vessels. ;Species reactivity: Sheep;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39 pg/mL

AVP ELISA Kit (Pig) (OKCA02520)

OKCA02520 96 Wells
EUR 930
Description: Description of target: Neurophysin 2 specifically binds vasopressin. Vasopressin has a direct antidiuretic action on the kidney, it also causes vasoconstriction of the peripheral vessels. ;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.39 pg/mL

AVP ELISA Kit (Bovine) (OKEH06587)

OKEH06587 96 Wells
EUR 779
Description: Description of target: Neurophysin 2 specifically binds vasopressin. Vasopressin has a direct antidiuretic action on the kidney, it also causes vasoconstriction of the peripheral vessels. ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 21 pg/mL

AVP ELISA Kit (Pig) (OKEH07373)

OKEH07373 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.7 pg/mL

Anti-MSLN (clone h7D9.v3)-Mc-MMAF ADC

ADC-W-454 1mg Ask for price
Description: This ADC product is comprised of an anti-MSLN monoclonal antibody (clone h7D9

Rabbit antidiuretic hormone/vasopressin/arginine vasopressin,ADH/VP/AVP ELISA kit

E04A1779-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit antidiuretic hormone/vasopressin/arginine vasopressin,ADH/VP/AVP in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit antidiuretic hormone/vasopressin/arginine vasopressin,ADH/VP/AVP ELISA kit

E04A1779-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit antidiuretic hormone/vasopressin/arginine vasopressin,ADH/VP/AVP in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit antidiuretic hormone/vasopressin/arginine vasopressin,ADH/VP/AVP ELISA kit

E04A1779-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit antidiuretic hormone/vasopressin/arginine vasopressin,ADH/VP/AVP in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CMV-Null control Adenovirus, in vivo ready

AVP-Null-PBS 1x1011 IFU/ml x 50ul
EUR 552
Description: Pre-made Null-control Adenovirus, provided in PBS solution.

Rabbit Anti Human Egf Receptor (C-Terminal) Polyclonal Antibody

CPBT-65685RH 50 µg
EUR 985

Rabbit Anti Rat Metabotropic Glutamate Receptor 1A Polyclonal Antibody

CPBT-66129RR 0.1 ml
EUR 944

Rabbit Anti Gaba A Receptor Alpha 1 Polyclonal Antibody

CPBT-66621RG 0.1 ml
EUR 944

Rabbit Anti Rat Nmda Receptor Nr2b (Pser1480) Polyclonal Antibody

CPBT-66739RR 0.1 ml
EUR 741

Interleukin 1 Receptor Antagonist (IL1RA) Polyclonal Antibody (Rabbit), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg26~Gln177
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Guinea polyclonal antibody against Rabbit Interleukin 1 Receptor Antagonist (IL1RA). This antibody is labeled with APC.

Interleukin 1 Receptor Antagonist (IL1RA) Polyclonal Antibody (Rabbit), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg26~Gln177
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Guinea polyclonal antibody against Rabbit Interleukin 1 Receptor Antagonist (IL1RA). This antibody is labeled with Biotin.

Interleukin 1 Receptor Antagonist (IL1RA) Polyclonal Antibody (Rabbit), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg26~Gln177
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Guinea polyclonal antibody against Rabbit Interleukin 1 Receptor Antagonist (IL1RA). This antibody is labeled with Cy3.

Interleukin 1 Receptor Antagonist (IL1RA) Polyclonal Antibody (Rabbit), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg26~Gln177
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Guinea polyclonal antibody against Rabbit Interleukin 1 Receptor Antagonist (IL1RA). This antibody is labeled with FITC.

Interleukin 1 Receptor Antagonist (IL1RA) Polyclonal Antibody (Rabbit), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg26~Gln177
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Guinea polyclonal antibody against Rabbit Interleukin 1 Receptor Antagonist (IL1RA). This antibody is labeled with HRP.

Interleukin 1 Receptor Antagonist (IL1RA) Polyclonal Antibody (Rabbit), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Arg26~Gln177
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Guinea polyclonal antibody against Rabbit Interleukin 1 Receptor Antagonist (IL1RA). This antibody is labeled with PE.

Bovine Arginine vasopressin, AVP ELISA Kit

CELI-66041b 96 Tests
EUR 928

Chicken Arginine vasopressin, AVP ELISA Kit

CELI-66041c 96 Tests
EUR 928

Canine Arginine vasopressin, AVP ELISA Kit

CELI-66041d 96 Tests
EUR 928

General Arginine vasopressin, AVP ELISA Kit

CELI-66041Ge 96 Tests
EUR 886

Human Arginine vasopressin, AVP ELISA Kit

CELI-66041h 96 Tests
EUR 824

Mouse Arginine vasopressin, AVP ELISA Kit

CELI-66041m 96 Tests
EUR 865

Porcine Arginine vasopressin, AVP ELISA Kit

CELI-66041p 96 Tests
EUR 928

Rat Arginine vasopressin, AVP ELISA Kit

CELI-66041r 96 Tests
EUR 886

Rat AVP V1b Control/blocking peptide

AVP1B13-P 100 ug
EUR 164

Rat AVP-V2 Control/blocking peptide

AVPV21-P 100 ug
EUR 164


EHA0745 96Tests
EUR 521


EGTA0745 96Tests
EUR 521


ECA0745 96Tests
EUR 521


EBA0745 96Tests
EUR 521


EAA0745 96Tests
EUR 521

Human arginine vasopressin(AVP)ELISA Kit

GA-E1329HM-48T 48T
EUR 289

Human arginine vasopressin(AVP)ELISA Kit

GA-E1329HM-96T 96T
EUR 466


ERA0745 96Tests
EUR 521

AVP sgRNA CRISPR Lentivector set (Human)

K0160401 3 x 1.0 ug
EUR 339


EPA0745 96Tests
EUR 521


EMA0745 96Tests
EUR 521

Human arginine vasopressin,AVP ELISA Kit

201-12-1313 96 tests
EUR 440
  • This arginine vasopressin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Dog arginine vasopressin (AVP) ELISA kit

CSB-EL002466DO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Dog arginine vasopressin (AVP) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Dog arginine vasopressin (AVP) ELISA kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Dog arginine vasopressin (AVP) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat arginine vasopressin (AVP) ELISA kit

CSB-E12684r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat arginine vasopressin (AVP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat arginine vasopressin (AVP) ELISA kit

  • EUR 500.00
  • EUR 3402.00
  • EUR 1820.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat arginine vasopressin (AVP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human arginine vasopressin,AVP ELISA Kit

CN-04568H1 96T
EUR 449

Human arginine vasopressin,AVP ELISA Kit

CN-04568H2 48T
EUR 299

Avp sgRNA CRISPR Lentivector set (Mouse)

K3818201 3 x 1.0 ug
EUR 339

Avp sgRNA CRISPR Lentivector set (Rat)

K7623801 3 x 1.0 ug
EUR 339

Human arginine vasopressin(AVP)ELISA Kit

QY-E02742 96T
EUR 361

Human NADH Ubiquinone Oxidoreductase Subunit V3 (NDUFV3) ELISA Kit

abx381751-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

VAHTS mRNA-Seq V3 Library Prep Kit for MGI

NRM611-01 24 rxn
EUR 1319

VAHTS mRNA-Seq V3 Library Prep Kit for MGI

NRM611-02 96 rxn
EUR 4036

VAHTS Universal DNA Library Prep Kit for Illumina V3

ND607-01 24 rxn
EUR 441

VAHTS Universal DNA Library Prep Kit for Illumina V3

ND607-02 96 rxn
EUR 1405

Recombinant HIV-1 gp 120 Protein (v3 loop region)

VAng-0537Lsx-inquire inquire Ask for price
Description: HIV type 1 Glycoprotein 120 (v3 loop region), recombinant protein from E. coli, with a GST tag and a 6-His tag. MW 35.7 kDa, 5.6 mg/mL.

Polyclonal Leptin Receptor Antibody

APR00299G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Leptin Receptor . This antibody is tested and proven to work in the following applications:

Polyclonal P2X2 Receptor Antibody

APR00494G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2X2 Receptor . This antibody is tested and proven to work in the following applications:

Polyclonal P2X3 Receptor Antibody

APR00514G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2X3 Receptor . This antibody is tested and proven to work in the following applications:

Polyclonal BAFF Receptor Antibody

APR03013G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAFF Receptor . This antibody is tested and proven to work in the following applications:

Polyclonal Nogo Receptor Antibody

AMM06739G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nogo Receptor . This antibody is tested and proven to work in the following applications:


Scroll to Top