CCL14 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

CCL14 Polyclonal Antibody
46832-50ul 50ul
EUR 187
CCL14 Polyclonal Antibody
A55419 100 µg
EUR 570.55
Description: kits suitable for this type of research
CCL14 Polyclonal Antibody
ABP58011-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CCL14 protein at amino acid sequence of 44-93
  • Applications tips:
Description: A polyclonal antibody for detection of CCL14 from Human. This CCL14 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL14 protein at amino acid sequence of 44-93
CCL14 Polyclonal Antibody
ABP58011-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CCL14 protein at amino acid sequence of 44-93
  • Applications tips:
Description: A polyclonal antibody for detection of CCL14 from Human. This CCL14 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL14 protein at amino acid sequence of 44-93
CCL14 Polyclonal Antibody
ABP58011-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCL14 protein at amino acid sequence of 44-93
  • Applications tips:
Description: A polyclonal antibody for detection of CCL14 from Human. This CCL14 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL14 protein at amino acid sequence of 44-93
CCL14 Polyclonal Antibody
ES8705-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCL14 from Human. This antibody is tested and validated for IHC, WB, ELISA
CCL14 Polyclonal Antibody
ES8705-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL14 from Human. This antibody is tested and validated for IHC, WB, ELISA
CCL14 Polyclonal Conjugated Antibody
C46832 100ul
EUR 397
Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit
DLR-CCL14-Hu-48T 48T
EUR 498
  • Should the Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-C-Motif Ligand 14 (CCL14) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit
DLR-CCL14-Hu-96T 96T
EUR 647
  • Should the Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-C-Motif Ligand 14 (CCL14) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit
RDR-CCL14-Hu-48Tests 48 Tests
EUR 522
Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit
RDR-CCL14-Hu-96Tests 96 Tests
EUR 724
Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit
RD-CCL14-Hu-48Tests 48 Tests
EUR 500
Human Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit
RD-CCL14-Hu-96Tests 96 Tests
EUR 692
CCL14 Antibody
43915-100ul 100ul
EUR 252
CCL14 Antibody
1-CSB-PA08947A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL14. Recognizes CCL14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Rabbit CCL14 ELISA Kit
ERTC0606 96Tests
EUR 521
CCL14 Polyclonal Antibody, HRP Conjugated
A55420 100 µg
EUR 570.55
Description: fast delivery possible
CCL14 Polyclonal Antibody, FITC Conjugated
A55421 100 µg
EUR 570.55
Description: reagents widely cited
CCL14 Polyclonal Antibody, Biotin Conjugated
A55422 100 µg
EUR 570.55
Description: Ask the seller for details
CCL14 Conjugated Antibody
C43915 100ul
EUR 397
Anti-CCL14 antibody
STJ98768 200 µl
EUR 197
Description: Rabbit polyclonal to CCL14.
CCL14 siRNA
20-abx910756
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CCL14
YF-PA14550 100 ug
EUR 403
Description: Rabbit polyclonal to CCL14
CCL14 Antibody, HRP conjugated
1-CSB-PA08947B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL14. Recognizes CCL14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CCL14 Antibody, FITC conjugated
1-CSB-PA08947C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL14. Recognizes CCL14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CCL14 Antibody, Biotin conjugated
1-CSB-PA08947D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL14. Recognizes CCL14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
CCL14 cloning plasmid
CSB-CL613691HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 282
  • Sequence: atgaagatctccgtggctgccattcccttcttcctcctcatcaccatcgccctagggaccaagactgaatcctcctcacggggaccttaccacccctcagagtgctgcttcacctacactacctacaagatcccgcgtcagcggattatggattactatgagaccaacagccagtg
  • Show more
Description: A cloning plasmid for the CCL14 gene.
pCMV-SPORT6-CCL14
PVT19029 2 ug
EUR 231
Anti-CCL14 (1F12)
YF-MA15361 100 ug
EUR 363
Description: Mouse monoclonal to CCL14
Anti-CCL14 (3B12)
YF-MA15362 100 ug
EUR 363
Description: Mouse monoclonal to CCL14
Anti-CCL14/Hcc 1 Antibody
A07151 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CCL14 Antibody (CCL14) detection.tested for IHC in Human.
CCL14 protein (His tag)
80R-1688 100 ug
EUR 305
Description: Purified recombinant Human CCL14 protein
HCC-1 (CCL14) Protein
20-abx260670
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
HCC-1 (CCL14) Protein
20-abx260679
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Human CCL14 ELISA Kit
EHC0606 96Tests
EUR 521
Goat CCL14 ELISA Kit
EGTC0606 96Tests
EUR 521
Bovine CCL14 ELISA Kit
EBC0606 96Tests
EUR 521
Canine CCL14 ELISA Kit
ECC0606 96Tests
EUR 521
Chicken CCL14 ELISA Kit
ECKC0606 96Tests
EUR 521
Anserini CCL14 ELISA Kit
EAC0606 96Tests
EUR 521
CCL14 ELISA KIT|Human
EF000044 96 Tests
EUR 689
Human CCL14 shRNA Plasmid
20-abx954291
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
HCC-1/CCL14, Human
HY-P7195 50ug
EUR 533
Mouse CCL14 ELISA Kit
EMC0606 96Tests
EUR 521
Rat CCL14 ELISA Kit
ERC0606 96Tests
EUR 521
Sheep CCL14 ELISA Kit
ESC0606 96Tests
EUR 521
Monkey CCL14 ELISA Kit
EMKC0606 96Tests
EUR 521
Porcine CCL14 ELISA Kit
EPC0606 96Tests
EUR 521
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human)
4-PAB122Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14)
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human)
4-PAB122Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14)
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), APC
4-PAB122Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with APC.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), Biotinylated
4-PAB122Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with Biotin.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), Cy3
4-PAB122Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with Cy3.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), FITC
4-PAB122Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with FITC.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), HRP
4-PAB122Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with HRP.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), PE
4-PAB122Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with PE.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), APC
4-PAB122Hu02-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with APC.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), Biotinylated
4-PAB122Hu02-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with Biotin.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), Cy3
4-PAB122Hu02-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with Cy3.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), FITC
4-PAB122Hu02-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with FITC.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), HRP
4-PAB122Hu02-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with HRP.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), PE
4-PAB122Hu02-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with PE.
Monoclonal CCL14 Antibody (monoclonal) (M01), Clone: 1F12
APG02470G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CCL14 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1F12. This antibody is applicable in WB, E
Rabbit Chemokine C-C-Motif Ligand 14 (CCL14) ELISA Kit
abx362515-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Recombinant Human HCC-1 (CCL14)
7-01894 2µg Ask for price
Recombinant Human HCC-1 (CCL14)
7-01895 10µg Ask for price
Recombinant Human HCC-1 (CCL14)
7-01896 1mg Ask for price
Guinea Pig CCL14 ELISA Kit
EGC0606 96Tests
EUR 521
CCL14 ORF Vector (Human) (pORF)
ORF002036 1.0 ug DNA
EUR 95
CCL14 ELISA Kit (Human) (OKAN05050)
OKAN05050 96 Wells
EUR 792
Description: Description of target: This gene, chemokine (C-C motif) ligand 14, is one of several CC cytokine genes clustered on 17q11.2. The CC cytokines are secreted proteins characterized by two adjacent cysteines. The cytokine encoded by this gene induces changes in intracellular calcium concentration and enzyme release in monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Read-through transcripts are also expressed that include exons from the upstream cytokine gene, chemokine (C-C motif) ligand 15, and are represented as GeneID: 348249.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL
CCL14 ELISA Kit (Human) (OKCD07164)
OKCD07164 96 Wells
EUR 936
Description: Description of target: Recombinant Human HCC-1 (CCL14);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), APC-Cy7
4-PAB122Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with APC-Cy7.
Chemokine C-C-Motif Ligand 14 (CCL14) Polyclonal Antibody (Human), APC-Cy7
4-PAB122Hu02-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL14 (Thr20~Asn93)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 14 (CCL14). This antibody is labeled with APC-Cy7.
Chemokine C-C-Motif Ligand 14 (CCL14) Antibody
20-abx103116
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Chemokine C-C-Motif Ligand 14 (CCL14) Antibody
20-abx128557
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Chemokine C-C-Motif Ligand 14 (CCL14) Antibody
20-abx109618
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Chemokine C-C-Motif Ligand 14 (CCL14) Antibody
20-abx171679
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
HCC-1 (CCL14) (66 a.a.) Protein
20-abx260657
  • EUR 328.00
  • EUR 3418.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
CCL14 sgRNA CRISPR Lentivector set (Human)
K0389701 3 x 1.0 ug
EUR 339
HCC-1 Human Recombinant Protein (CCL14)
PROTQ16627-2 Regular: 10ug
EUR 317
Description: HCC-1 Human Recombinant produced in E.Coli is a single,non-glycosylated, polypeptide chain containing 72 amino acids and having a molecular mass of 8411 Dalton. ;The HCC-1 is purified by proprietary chromatographic techniques.
HCC-1, CCL14 (66 a.a.), human
RC315-25A 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
Recombinant (E.Coli) Human HCC-1 (CCL14)
RP-1015 10 ug
EUR 286
Chemokine C-C-Motif Ligand 14 (CCL14) Antibody (Biotin)
20-abx105232
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Chemokine C-C-Motif Ligand 14 (CCL14) Antibody (FITC)
20-abx106650
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Chemokine C-C-Motif Ligand 14 (CCL14) Antibody (HRP)
20-abx108067
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Chemokine C-C-Motif Ligand 14 (CCL14) Antibody (Biotin)
20-abx272091
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Recombinant Human HCC-1 (CCL14) His Tag
7-01897 2µg Ask for price
Recombinant Human HCC-1 (CCL14) His Tag
7-01898 10µg Ask for price
Recombinant Human HCC-1 (CCL14) His Tag
7-01899 1mg Ask for price
CCL14/HCC-1/HCC-3, human recombinant
4275-10
EUR 229
CCL14/HCC-1/HCC-3, human recombinant
4275-1000
EUR 3932
CCL14/HCC-1/HCC-3, human recombinant
4275-50
EUR 566
Human C-C motif chemokine 14 (CCL14)
1-CSB-EP613691HU(F)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human C-C motif chemokine 14(CCL14) expressed in E.coli
ELISA kit for Human CCL14/HCC-1
EK5484 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CCL14/HCC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human CCL14/HCC-1 PicoKine ELISA Kit
EK1123 96 wells
EUR 425
Description: For quantitative detection of human CCL14 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
CCL14 sgRNA CRISPR Lentivector (Human) (Target 1)
K0389702 1.0 ug DNA
EUR 154
CCL14 sgRNA CRISPR Lentivector (Human) (Target 2)
K0389703 1.0 ug DNA
EUR 154
CCL14 sgRNA CRISPR Lentivector (Human) (Target 3)
K0389704 1.0 ug DNA
EUR 154
CCL14 Protein Vector (Human) (pPB-C-His)
PV008141 500 ng
EUR 329
CCL14 Protein Vector (Human) (pPB-N-His)
PV008142 500 ng
EUR 329
CCL14 Protein Vector (Human) (pPM-C-HA)
PV008143 500 ng
EUR 329
CCL14 Protein Vector (Human) (pPM-C-His)
PV008144 500 ng
EUR 329
CCL14 3'UTR GFP Stable Cell Line
TU053759 1.0 ml
EUR 1394
CCL14 3'UTR Luciferase Stable Cell Line
TU003759 1.0 ml
EUR 1394
CCL14/HCC-1 ELISA Kit (Human) (OKBB00501)
OKBB00501 96 Wells
EUR 505
Description: Description of target: Chemokine (C-C motif) ligand 14 (CCL14) is a small cytokine belonging to the CC chemokine family. It is also commonly known as HCC-1. It is produced as a protein precursor that is processed to generate a mature active protein containing 74 amino acids that and is 46% identical in amino acid composition to CCL3 and CCL4. This chemokine is expressed in various tissues including spleen, bone marrow, liver, muscle, and gut. CCL14 activates monocytes, but does not induce their chemotaxis. In addition, HCC-1 enhanced the proliferation of CD34+ myeloid progenitor cells. It was as effective as MIP-1 alpha, but about 100-fold less potent. Human CCL14 is located on chromosome 17 within a cluster of other chemokines belonging to the CC family.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL
CCL14 Chemi-Luminescent ELISA Kit (Human) (OKCD05561)
OKCD05561 96 Wells
EUR 1144
Description: Description of target: Recombinant Human HCC-1 (CCL14);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.54pg/mL
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

 

Scroll to Top