CD300a Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

CD300a Polyclonal Antibody

ES8794-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD300a from Human. This antibody is tested and validated for IHC, WB, ELISA

CD300A Rabbit pAb

A10006-100ul 100 ul
EUR 308

CD300A Rabbit pAb

A10006-200ul 200 ul
EUR 459

CD300A Rabbit pAb

A10006-20ul 20 ul
EUR 183

CD300A Rabbit pAb

A10006-50ul 50 ul
EUR 223

CD300A Antibody

45302-100ul 100ul
EUR 252

CD300A Antibody

45302-50ul 50ul
EUR 187

CD300A Antibody

1-CSB-PA887023ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD300A. Recognizes CD300A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CD300A Antibody

1-CSB-PA887023ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD300A. Recognizes CD300A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CD300A Antibody

DF8434 200ul
EUR 304
Description: CD300A Antibody detects endogenous levels of total CD300A.

CD300A Antibody

ABD8434 100 ug
EUR 438

CD300a Antibody (APC)

abx140479-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

Anti-CD300A antibody

STJ112046 100 µl
EUR 277
Description: This gene encodes a member of the CD300 glycoprotein family of cell surface proteins found on leukocytes involved in immune response signaling pathways. This gene is located on chromosome 17 in a cluster with all but one of the other family members. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CD300a antibody

STJ98999 200 µl
EUR 197
Description: Rabbit polyclonal to CD300a.

Cd300a/ Rat Cd300a ELISA Kit

ELI-50989r 96 Tests
EUR 886

CD300A Protein

20-abx262674
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

CD300A siRNA

20-abx910992
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD300A siRNA

20-abx910993
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CD300A

YF-PA27501 50 ug
EUR 363
Description: Mouse polyclonal to CD300A

CD300A Blocking Peptide

DF8434-BP 1mg
EUR 195

CD300A, human recombinant

7341-50
EUR 370

CD300A cloning plasmid

CSB-CL887023HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 900
  • Sequence: atgtggctgccttgggctctgttgcttctctgggtcccaggatgttttgctctgagcaaatgcaggaccgtggcgggccccgtggggggatccctgagtgtgcagtgtccctatgagaaggaacacaggaccctcaacaaatactggtgcagaccaccacagattttcctatgtga
  • Show more
Description: A cloning plasmid for the CD300A gene.

Human CD300A (CLM-8) Antibody

33214-05111 150 ug
EUR 261

Rabbit CMRF35 like molecule 8(CD300A) ELISA kit

E04C1477-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CMRF35 like molecule 8(CD300A) ELISA kit

E04C1477-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CMRF35 like molecule 8(CD300A) ELISA kit

E04C1477-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CMRF35-Like Molecule 8 (CD300A) Antibody

20-abx135925
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

abx146214-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

20-abx149077
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

abx139997-01mg 0.1 mg
EUR 384
  • Shipped within 5-12 working days.

Mouse Anti Human Cd300a Monoclonal Antibody

CABT-47528MH 0.1 mg
EUR 715

CMRF35-Like Molecule 8 (CD300A) Antibody

abx414508-01mg 0.1 mg
EUR 439
  • Shipped within 1 week.

CMRF35-Like Molecule 8 (CD300A) Antibody

20-abx321205
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

20-abx322634
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

abx415163-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Anti-Hu CD300a Purified

11-501-C025 0.025 mg
EUR 108

Anti-Hu CD300a Purified

11-501-C100 0.1 mg
EUR 177

Anti-Hu CD300a APC

1A-501-T100 100 tests
EUR 240

Anti-Hu CD300a PE

1P-501-T025 25 tests
EUR 140

Anti-Hu CD300a PE

1P-501-T100 100 tests
EUR 240

CD300A protein (His tag)

80R-2938 50 ug
EUR 327
Description: Purified recombinant HMGB3 protein (His tag)

Human CD300A shRNA Plasmid

20-abx957744
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CD300A shRNA Plasmid

20-abx981104
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD300A Human Recombinant Protein

PROTQ9UGN4 Regular: 10ug
EUR 317
Description: CD300A Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 134 amino acids (18-128) and having a molecular mass of 14.7kDa.

 

Scroll to Top