Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa.

Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa.

Zaldivar-Riverón, A., Areekul, B., Shaw, M. R. & Quicke, D. L. J. (2004). Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa. –Zoologica Scripta33, 223-237.

The morphology of the venom apparatus intima in representatives of 38 genera of the problematic braconid wasp subfamily Rogadinae and different cyclostome braconids was investigated and a preliminary phylogenetic evaluation for the group was carried out with the data obtained. Despite the restricted quantity of characters, the knowledge counsel a number of relationships at numerous taxonomic ranges.

The venom apparatus in the Clinocentrini and the Stiropiini is comparatively unmodified and much like that discovered in different genera beforehand positioned inside a broader idea of the Rogadinae (e.g. genera of Lysitermini, Pentatermini, Tetratermini, Hormiini) and additionally to that of the Betylobraconinae.

The presence of a cone of filaments situated inside the secondary venom duct close to to its insertion on the venom reservoir/main venom duct is proposed as a synapomorphy for the tribe Rogadini to the exclusion of Stiropiini, Clinocentrini and Yeliconini.

Other options of the secondary venom duct and its insertion on the venom reservoir/main venom duct assist a quantity of relationships between the genera of the Rogadini and additionally inside the massive genus Aleiodes. A clade containing 15 Rogadini genera (BathotecaBathotecoidesBulborogasCanalirogasColastomionConspinariaCystomastacoidesMacrostomionMegarhogasMyocronPholichoraRectivena, RogasSpinaria and Triraphis) is supported by the presence of a thickened and quick secondary venom duct, whereas the completely different members of Aleiodes (excluding members of the subgenus Heterogamus) and Cordylorhogas are distinguished by having a recessed secondary venom duct with well-defined and quite a few inner filaments.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DLR-ALPI-Hu-96T 96T
EUR 647
  • Should the Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Alkaline Phosphatase, Intestinal (ALPI) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DLR-ALPI-Ra-48T 48T
EUR 528
  • Should the Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Alkaline Phosphatase, Intestinal (ALPI) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DLR-ALPI-Ra-96T 96T
EUR 690
  • Should the Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Alkaline Phosphatase, Intestinal (ALPI) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RD-ALPI-Hu-48Tests 48 Tests
EUR 500

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RD-ALPI-Hu-96Tests 96 Tests
EUR 692

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RD-ALPI-Ra-48Tests 48 Tests
EUR 534

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RD-ALPI-Ra-96Tests 96 Tests
EUR 742

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RDR-ALPI-Hu-48Tests 48 Tests
EUR 522

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RDR-ALPI-Hu-96Tests 96 Tests
EUR 724

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RDR-ALPI-Ra-48Tests 48 Tests
EUR 558

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RDR-ALPI-Ra-96Tests 96 Tests
EUR 776

ALPI protein

30R-3266 50 ug
EUR 257
Description: Purified recombinant ALPI protein

ALPI antibody

70R-15272 100 ug
EUR 327
Description: Rabbit polyclonal ALPI antibody

ALPI Antibody

36164-100ul 100ul
EUR 252

ALPI Antibody

1-CSB-PA11989A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ALPI Antibody

1-CSB-PA921124
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ALPI antibody

70R-49364 100 ul
EUR 244
Description: Purified Polyclonal ALPI antibody

ALPI siRNA

20-abx907328
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ALPI antibody (HRP)

60R-1654 100 ug
EUR 327
Description: Rabbit polyclonal ALPI antibody (HRP)

ALPI antibody (FITC)

60R-1655 100 ug
EUR 327
Description: Rabbit polyclonal ALPI antibody (FITC)

ALPI antibody (biotin)

60R-1656 100 ug
EUR 327
Description: Rabbit polyclonal ALPI antibody (biotin)

ALPI Blocking Peptide

20-abx062239
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ALPI Conjugated Antibody

C36164 100ul
EUR 397

ALPI cloning plasmid

CSB-CL001627HU-10ug 10ug
EUR 553
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atgcaggggccctgggtgctgctgctgctgggcctgaggctacagctctccctgggcgtcatcccagctgaggaggagaacccggccttctggaaccgccaggcagctgaggccctggatgctgccaagaagctgcagcccatccagaaggtcgccaagaacctcatcctcttcc
  • Show more
Description: A cloning plasmid for the ALPI gene.

ALPI Rabbit pAb

A6226-100ul 100 ul
EUR 308

ALPI Rabbit pAb

A6226-200ul 200 ul
EUR 459

ALPI Rabbit pAb

A6226-20ul 20 ul
EUR 183

ALPI Rabbit pAb

A6226-50ul 50 ul
EUR 223

ALPI Polyclonal Antibody

A52182 100 µg
EUR 570.55
Description: reagents widely cited

Anti-ALPI antibody

STJ27982 100 µl
EUR 277
Description: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut.

ALPI Antibody, HRP conjugated

1-CSB-PA11989B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ALPI Antibody, FITC conjugated

1-CSB-PA11989C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ALPI Antibody, Biotin conjugated

1-CSB-PA11989D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Alkaline Phosphatase (ALPI) Antibody

20-abx101821
  • EUR 328.00
  • EUR 133.00
  • EUR 885.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alkaline Phosphatase (ALPI) Antibody

20-abx101822
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alkaline Phosphatase (ALPI) Antibody

abx028323-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alkaline Phosphatase (ALPI) Antibody

abx028323-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human ALPI ELISA Kit

ELA-E0233h 96 Tests
EUR 824

Human ALPI ELISA Kit

EHA0377 96Tests
EUR 521

Human ALPI ELISA Kit

ELA-E66904h 96 Tests
EUR 678

Goat ALPI ELISA Kit

EGTA0377 96Tests
EUR 521

Canine ALPI ELISA Kit

ECA0377 96Tests
EUR 521

Chicken ALPI ELISA Kit

ECKA0377 96Tests
EUR 521

Anserini ALPI ELISA Kit

EAA0377 96Tests
EUR 521

Bovine ALPI ELISA Kit

EBA0377 96Tests
EUR 521

ALPI ELISA KIT|Human

EF007455 96 Tests
EUR 689

Human ALPI shRNA Plasmid

20-abx950172
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ALPI ELISA Kit

EMA0377 96Tests
EUR 521

Rat ALPI ELISA Kit

ERA0377 96Tests
EUR 521

Sheep ALPI ELISA Kit

ESA0377 96Tests
EUR 521

Rabbit ALPI ELISA Kit

ERTA0377 96Tests
EUR 521

Monkey ALPI ELISA Kit

EMKA0377 96Tests
EUR 521

Porcine ALPI ELISA Kit

EPA0377 96Tests
EUR 521

ALPI Recombinant Protein (Human)

RP036577 100 ug Ask for price

ChickenAlkaline Phosphatase Intestinal (ALPI)

QY-E80141 96T
EUR 426

ALPI Recombinant Protein (Mouse)

RP115481 100 ug Ask for price

ALPI Recombinant Protein (Rat)

RP189998 100 ug Ask for price

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx009597
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx006328
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

abx015768-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

abx015769-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx175318
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx175319
  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx210488
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx109946
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

abx145597-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx171155
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx171156
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Guinea Pig ALPI ELISA Kit

EGA0377 96Tests
EUR 521

Polyclonal ALPI / Alkaline Phosphatase Antibody

APG01829G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ALPI / Alkaline Phosphatase . This antibody is tested and proven to work in the following applications:

Monoclonal ALPI Antibody, Clone: 3B10E7

APG01832G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human ALPI. The antibodies are raised in Mouse and are from clone 3B10E7. This antibody is applicable in WB, FC, E

Monoclonal ALPI Antibody, Clone: 3B10E7

APG01833G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human ALPI. The antibodies are raised in Mouse and are from clone 3B10E7. This antibody is applicable in WB, FC, E

ALPI Polyclonal Antibody, HRP Conjugated

A52183 100 µg
EUR 570.55
Description: Ask the seller for details

ALPI Polyclonal Antibody, FITC Conjugated

A52184 100 µg
EUR 570.55
Description: The best epigenetics products

ALPI Polyclonal Antibody, Biotin Conjugated

A52185 100 µg
EUR 570.55
Description: kits suitable for this type of research

Alpi ORF Vector (Rat) (pORF)

ORF063334 1.0 ug DNA
EUR 506

ALPI ORF Vector (Human) (pORF)

ORF012193 1.0 ug DNA
EUR 354

Alpi ORF Vector (Mouse) (pORF)

ORF038495 1.0 ug DNA
EUR 506

ALPI ELISA Kit (Human) (OKAN05296)

OKAN05296 96 Wells
EUR 792
Description: Description of target: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.55 ng/mL

ALPI ELISA Kit (Human) (OKCD07126)

OKCD07126 96 Wells
EUR 936
Description: Description of target: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is upregulated during small intestinal epithelial cell differentiation.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.63ng/mL

ALPI ELISA Kit (Rat) (OKCD07127)

OKCD07127 96 Wells
EUR 1001
Description: Description of target: catalyzes the conversion of an orthophosphoric monoester to an alcohol phosphate.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.33ng/mL

ALPI ELISA Kit (Bovine) (OKEH03826)

OKEH03826 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23 pg/mL

ALPI ELISA Kit (Rat) (OKEH04166)

OKEH04166 96 Wells
EUR 662
Description: Description of target: catalyzes the conversion of an orthophosphoric monoester to an alcohol phosphate [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.88 ng/mL

Human Intestinal-type alkaline phosphatase (ALPI)

1-CSB-RP119894h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Intestinal-type alkaline phosphatase(ALPI),partial expressed in E.coli

Human Intestinal-type alkaline phosphatase (ALPI)

1-CSB-YP001627HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Intestinal-type alkaline phosphatase(ALPI) expressed in Yeast

Alkaline Phosphatase, Intestinal (ALPI) Antibody (Biotin)

20-abx105596
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody (FITC)

20-abx107014
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody (HRP)

20-abx108435
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody Pair

abx117516-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Polyclonal ALPI / Alkaline Phosphatase Antibody (Internal)

APG01831G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ALPI / Alkaline Phosphatase (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal Alkaline Phosphatase (ALPI) Antibody (Center)

APR07058G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Alkaline Phosphatase (ALPI) (Center). This antibody is tested and proven to work in the following applications:

Human Alkaline Phosphatase, Intestinal (ALPI) Protein

20-abx652455
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Alkaline Phosphatase, Intestinal (ALPI) Protein

20-abx652456
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Alpi sgRNA CRISPR Lentivector set (Rat)

K6894701 3 x 1.0 ug
EUR 339

Alpi sgRNA CRISPR Lentivector set (Mouse)

K3179201 3 x 1.0 ug
EUR 339

ALPI sgRNA CRISPR Lentivector set (Human)

K0076701 3 x 1.0 ug
EUR 339

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

20-abx150628
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

20-abx155185
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

abx256701-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

New World Rogas species exhibit a novel venom apparatus and might not be intently related to the Old World ones. Features of the venom apparatus of the enigmatic genus Telengaia and the exothecine genera Shawiana and Colastes counsel that the Telengainae and Exothecinae are each intently related to the Braconinae, Gnamptodontinae, and presumably to the Opiinae and Alysiinae. An unsculptured venom reservoir was discovered in one specimen of the kind species of AvgaA. choaspes, which is in line with it occupying both a really basal place inside the cyclostome braconids or belonging to a not too long ago acknowledged ‘Gondwanan’ clade that additionally consists of the Aphidiinae.

Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa.
Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa.

Discovery of Raphidioptera (Insecta: Neuropterida) in Xizang, China, with description of a brand new species of Inocellia Schneider.

The holometabolous order Raphidioptera is recorded from Xizang Autonomous Region for the first time. A brand new species of the household Inocelliidae, Inocellia tibetana sp. nov., from southeastern Xizang is described and its two sexes illustrated.

Based on the male gonocoxite 9 that’s longer than width of its base, the new species belongs to the I. fulvostigmata species-group, and it seems to be intently related to I. fulvostigmata U. Aspöck, Rausch H.

Aspöck, 1968. Both species are distributed close to the southern edge of the Himalayas. The male of the new species is characterised in the genitalia by the presence of a membranous, quick and digitiform gonostylus 9, the gonarcus (fused gonocoxites 11) subtriangular in caudal view dorsally with a pair of quick tubercular processes, and the discount of bristle tuft on the endophallus.

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top