Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa.

Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa.

Zaldivar-Riverón, A., Areekul, B., Shaw, M. R. & Quicke, D. L. J. (2004). Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa. –Zoologica Scripta33, 223-237.

The morphology of the venom apparatus intima in representatives of 38 genera of the problematic braconid wasp subfamily Rogadinae and different cyclostome braconids was investigated and a preliminary phylogenetic evaluation for the group was carried out with the data obtained. Despite the restricted quantity of characters, the knowledge counsel a number of relationships at numerous taxonomic ranges.

The venom apparatus in the Clinocentrini and the Stiropiini is comparatively unmodified and much like that discovered in different genera beforehand positioned inside a broader idea of the Rogadinae (e.g. genera of Lysitermini, Pentatermini, Tetratermini, Hormiini) and additionally to that of the Betylobraconinae.

The presence of a cone of filaments situated inside the secondary venom duct close to to its insertion on the venom reservoir/main venom duct is proposed as a synapomorphy for the tribe Rogadini to the exclusion of Stiropiini, Clinocentrini and Yeliconini.

Other options of the secondary venom duct and its insertion on the venom reservoir/main venom duct assist a quantity of relationships between the genera of the Rogadini and additionally inside the massive genus Aleiodes. A clade containing 15 Rogadini genera (BathotecaBathotecoidesBulborogasCanalirogasColastomionConspinariaCystomastacoidesMacrostomionMegarhogasMyocronPholichoraRectivena, RogasSpinaria and Triraphis) is supported by the presence of a thickened and quick secondary venom duct, whereas the completely different members of Aleiodes (excluding members of the subgenus Heterogamus) and Cordylorhogas are distinguished by having a recessed secondary venom duct with well-defined and quite a few inner filaments.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DL-ALPI-Hu-48 1 kit of 48 tests
EUR 465.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Alkaline Phosphatase, Intestinal (ALPI)

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DL-ALPI-Hu-96 1 kit of 96 tests
EUR 621.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Alkaline Phosphatase, Intestinal (ALPI)

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DL-ALPI-Ra-192 1 kit of 192 tests
EUR 1183.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Alkaline Phosphatase, Intestinal (ALPI)

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DL-ALPI-Ra-48 1 kit of 48 tests
EUR 493.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Alkaline Phosphatase, Intestinal (ALPI)

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DL-ALPI-Ra-96 1 kit of 96 tests
EUR 661.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Alkaline Phosphatase, Intestinal (ALPI)

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DLR-ALPI-Hu-48T 48T
EUR 498.00
  • Should the Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Alkaline Phosphatase, Intestinal (ALPI) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DLR-ALPI-Hu-96T 96T
EUR 647.00
  • Should the Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Alkaline Phosphatase, Intestinal (ALPI) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DLR-ALPI-Ra-48T 48T
EUR 528.00
  • Should the Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Alkaline Phosphatase, Intestinal (ALPI) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

DLR-ALPI-Ra-96T 96T
EUR 690.00
  • Should the Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Alkaline Phosphatase, Intestinal (ALPI) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RDR-ALPI-Hu-48Tests 48 Tests
EUR 522.00

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RDR-ALPI-Hu-96Tests 96 Tests
EUR 724.00

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RDR-ALPI-Ra-48Tests 48 Tests
EUR 558.00

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RDR-ALPI-Ra-96Tests 96 Tests
EUR 776.00

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RD-ALPI-Hu-48Tests 48 Tests
EUR 500.00

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RD-ALPI-Hu-96Tests 96 Tests
EUR 692.00

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RD-ALPI-Ra-48Tests 48 Tests
EUR 534.00

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

RD-ALPI-Ra-96Tests 96 Tests
EUR 742.00

ALPI Antibody

1-CSB-PA11989A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ALPI protein

30R-3266 50 ug
EUR 257.00
Description: Purified recombinant ALPI protein

ALPI Antibody

36164-100ul 100ul
EUR 252.00

ALPI antibody

70R-49364 100 ul
EUR 244.00
Description: Purified Polyclonal ALPI antibody

ALPI siRNA

20-abx907328
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ALPI Antibody

1-CSB-PA921124
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ALPI antibody

70R-15272 100 ug
EUR 327.00
Description: Rabbit polyclonal ALPI antibody

ALPI Conjugated Antibody

C36164 100ul
EUR 397.00

ALPI cloning plasmid

CSB-CL001627HU-10ug 10ug
EUR 553.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atgcaggggccctgggtgctgctgctgctgggcctgaggctacagctctccctgggcgtcatcccagctgaggaggagaacccggccttctggaaccgccaggcagctgaggccctggatgctgccaagaagctgcagcccatccagaaggtcgccaagaacctcatcctcttcc
  • Show more
Description: A cloning plasmid for the ALPI gene.

ALPI Polyclonal Antibody

A52182 100 µg
EUR 570.55
Description: reagents widely cited

ALPI Rabbit pAb

A6226-100ul 100 ul
EUR 308.00

ALPI Rabbit pAb

A6226-200ul 200 ul
EUR 459.00

ALPI Rabbit pAb

A6226-20ul 20 ul
EUR 183.00

ALPI Rabbit pAb

A6226-50ul 50 ul
EUR 223.00

ALPI antibody (HRP)

60R-1654 100 ug
EUR 327.00
Description: Rabbit polyclonal ALPI antibody (HRP)

ALPI antibody (FITC)

60R-1655 100 ug
EUR 327.00
Description: Rabbit polyclonal ALPI antibody (FITC)

ALPI antibody (biotin)

60R-1656 100 ug
EUR 327.00
Description: Rabbit polyclonal ALPI antibody (biotin)

ALPI Blocking Peptide

20-abx062239
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ALPI Polyclonal Antibody

E-AB-10869-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like
  • Show more
Description: Rabbit antibody against Human ALPI for IHC,ELISA applications.

ALPI Polyclonal Antibody

E-AB-10869-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like
  • Show more
Description: Rabbit antibody against Human ALPI for IHC,ELISA applications.

ALPI Polyclonal Antibody

E-AB-10869-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like
  • Show more
Description: Rabbit antibody against Human ALPI for IHC,ELISA applications.

Anti-ALPI antibody

STJ27982 100 µl
EUR 277.00
Description: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut.

Alkaline Phosphatase (ALPI) Antibody

20-abx101821
  • EUR 328.00
  • EUR 133.00
  • EUR 885.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alkaline Phosphatase (ALPI) Antibody

20-abx101822
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ALPI Antibody, HRP conjugated

1-CSB-PA11989B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ALPI Antibody, FITC conjugated

1-CSB-PA11989C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ALPI Antibody, Biotin conjugated

1-CSB-PA11989D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALPI. Recognizes ALPI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Alkaline Phosphatase (ALPI) Antibody

abx028323-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Alkaline Phosphatase (ALPI) Antibody

abx028323-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Human ALPI shRNA Plasmid

20-abx950172
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sheep ALPI ELISA Kit

ESA0377 96Tests
EUR 521.00

Mouse ALPI ELISA Kit

EMA0377 96Tests
EUR 521.00

Rat ALPI ELISA Kit

ERA0377 96Tests
EUR 521.00

Rabbit ALPI ELISA Kit

ERTA0377 96Tests
EUR 521.00

Monkey ALPI ELISA Kit

EMKA0377 96Tests
EUR 521.00

Porcine ALPI ELISA Kit

EPA0377 96Tests
EUR 521.00

Human ALPI ELISA Kit

EHA0377 96Tests
EUR 521.00

Goat ALPI ELISA Kit

EGTA0377 96Tests
EUR 521.00

Bovine ALPI ELISA Kit

EBA0377 96Tests
EUR 521.00

Anserini ALPI ELISA Kit

EAA0377 96Tests
EUR 521.00

Human ALPI ELISA Kit

ELA-E66904h 96 Tests
EUR 678.00

Human ALPI ELISA Kit

ELA-E0233h 96 Tests
EUR 824.00

Canine ALPI ELISA Kit

ECA0377 96Tests
EUR 521.00

Chicken ALPI ELISA Kit

ECKA0377 96Tests
EUR 521.00

ALPI ELISA KIT|Human

EF007455 96 Tests
EUR 689.00

ALPI Recombinant Protein (Human)

RP036577 100 ug Ask for price

ALPI Recombinant Protein (Rat)

RP189998 100 ug Ask for price

ALPI Recombinant Protein (Mouse)

RP115481 100 ug Ask for price

ChickenAlkaline Phosphatase Intestinal (ALPI)

QY-E80141 96T
EUR 426.00

Alkaline Phosphatase, Intestinal (ALPI) Antibody

abx145597-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx171155
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx171156
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx109946
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyclonal ALPI / Alkaline Phosphatase Antibody

APG01829G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ALPI / Alkaline Phosphatase . This antibody is tested and proven to work in the following applications:

Monoclonal ALPI Antibody, Clone: 3B10E7

APG01832G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human ALPI. The antibodies are raised in Mouse and are from clone 3B10E7. This antibody is applicable in WB, FC, E

Monoclonal ALPI Antibody, Clone: 3B10E7

APG01833G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human ALPI. The antibodies are raised in Mouse and are from clone 3B10E7. This antibody is applicable in WB, FC, E

ALPI Polyclonal Antibody, HRP Conjugated

A52183 100 µg
EUR 570.55
Description: Ask the seller for details

ALPI Polyclonal Antibody, FITC Conjugated

A52184 100 µg
EUR 570.55
Description: The best epigenetics products

ALPI Polyclonal Antibody, Biotin Conjugated

A52185 100 µg
EUR 570.55
Description: kits suitable for this type of research

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx009597
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

abx015768-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

abx015769-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx006328
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx210488
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx175318
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alkaline Phosphatase, Intestinal (ALPI) Antibody

20-abx175319
  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Guinea Pig ALPI ELISA Kit

EGA0377 96Tests
EUR 521.00

ALPI ORF Vector (Human) (pORF)

ORF012193 1.0 ug DNA
EUR 354.00

Alpi ORF Vector (Mouse) (pORF)

ORF038495 1.0 ug DNA
EUR 506.00

Alpi ORF Vector (Rat) (pORF)

ORF063334 1.0 ug DNA
EUR 506.00

Alkaline Phosphatase, Intestinal (ALPI) Antibody Pair

abx117516-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010.00
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody (Biotin)

20-abx105596
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody (FITC)

20-abx107014
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alkaline Phosphatase, Intestinal (ALPI) Antibody (HRP)

20-abx108435
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyclonal ALPI / Alkaline Phosphatase Antibody (Internal)

APG01831G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ALPI / Alkaline Phosphatase (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal Alkaline Phosphatase (ALPI) Antibody (Center)

APR07058G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Alkaline Phosphatase (ALPI) (Center). This antibody is tested and proven to work in the following applications:

Human Alkaline Phosphatase, Intestinal (ALPI) Protein

20-abx652455
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Alkaline Phosphatase, Intestinal (ALPI) Protein

20-abx652456
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Intestinal-type alkaline phosphatase (ALPI)

1-CSB-RP119894h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Intestinal-type alkaline phosphatase(ALPI),partial expressed in E.coli

Human Intestinal-type alkaline phosphatase (ALPI)

1-CSB-YP001627HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Intestinal-type alkaline phosphatase(ALPI) expressed in Yeast

ALPI sgRNA CRISPR Lentivector set (Human)

K0076701 3 x 1.0 ug
EUR 339.00

Alpi sgRNA CRISPR Lentivector set (Mouse)

K3179201 3 x 1.0 ug
EUR 339.00

Alpi sgRNA CRISPR Lentivector set (Rat)

K6894701 3 x 1.0 ug
EUR 339.00

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

20-abx155185
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

20-abx150628
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

abx573542-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

abx573789-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.

Cow Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

abx512296-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Human Alkaline Phosphatase, Intestinal (ALPI) CLIA Kit

20-abx492400
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Alkaline Phosphatase, Intestinal (ALPI) CLIA Kit

20-abx492401
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

abx256701-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.

Rat Alkaline Phosphatase, Intestinal(ALPI) ELISA Kit

ER0727 96T
EUR 524.10
  • Detection range: 0.781-50 ng/ml
  • Alias: Alkaline Phosphatase, Intestinal/Alpi/Intestinal alkaline phosphatase I/IAP-I
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.469 ng/ml

Human ALPI(Alkaline Phosphatase, Intestinal) ELISA Kit

EH4303 96T
EUR 567.60
  • Detection range: 1.563-100 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Bovine ALPI(Alkaline Phosphatase, Intestinal) ELISA Kit

EB0098 96T
EUR 567.60
  • Detection range: 1.563-100 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 0.938 ng/ml

ALPI sgRNA CRISPR Lentivector (Human) (Target 1)

K0076702 1.0 ug DNA
EUR 154.00

ALPI sgRNA CRISPR Lentivector (Human) (Target 2)

K0076703 1.0 ug DNA
EUR 154.00

ALPI sgRNA CRISPR Lentivector (Human) (Target 3)

K0076704 1.0 ug DNA
EUR 154.00

Alpi sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3179202 1.0 ug DNA
EUR 154.00

Alpi sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3179203 1.0 ug DNA
EUR 154.00

Alpi sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3179204 1.0 ug DNA
EUR 154.00

Alpi sgRNA CRISPR Lentivector (Rat) (Target 1)

K6894702 1.0 ug DNA
EUR 154.00

Alpi sgRNA CRISPR Lentivector (Rat) (Target 2)

K6894703 1.0 ug DNA
EUR 154.00

Alpi sgRNA CRISPR Lentivector (Rat) (Target 3)

K6894704 1.0 ug DNA
EUR 154.00

ALPI Protein Vector (Human) (pPB-His-MBP)

PV321410 500 ng
EUR 481.00

ALPI Protein Vector (Human) (pPB-His-GST)

PV321411 500 ng
EUR 481.00

ALPI Protein Vector (Rat) (pPB-C-His)

PV253334 500 ng
EUR 603.00

ALPI Protein Vector (Rat) (pPB-N-His)

PV253335 500 ng
EUR 603.00

ALPI Protein Vector (Rat) (pPM-C-HA)

PV253336 500 ng
EUR 603.00

ALPI Protein Vector (Rat) (pPM-C-His)

PV253337 500 ng
EUR 603.00

ALPI Protein Vector (Mouse) (pPB-C-His)

PV153978 500 ng
EUR 603.00

ALPI Protein Vector (Mouse) (pPB-N-His)

PV153979 500 ng
EUR 603.00

ALPI Protein Vector (Mouse) (pPM-C-HA)

PV153980 500 ng
EUR 603.00

ALPI Protein Vector (Mouse) (pPM-C-His)

PV153981 500 ng
EUR 603.00

ALPI Protein Vector (Human) (pPB-C-His)

PV048769 500 ng
EUR 481.00

ALPI Protein Vector (Human) (pPB-N-His)

PV048770 500 ng
EUR 481.00

ALPI Protein Vector (Human) (pPM-C-HA)

PV048771 500 ng
EUR 481.00

ALPI Protein Vector (Human) (pPM-C-His)

PV048772 500 ng
EUR 481.00

Human Alkaline Phosphatase, Intestinal ELISA Kit (ALPI)

RK00870 96 Tests
EUR 521.00

ALPI 3'UTR Luciferase Stable Cell Line

TU000659 1.0 ml
EUR 1521.00

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

SEB085Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alkaline Phosphatase, Intestinal (ALPI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alkaline Phosphatase, Intestinal (ALPI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

SEB085Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alkaline Phosphatase, Intestinal (ALPI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alkaline Phosphatase, Intestinal (ALPI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

SEB085Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alkaline Phosphatase, Intestinal (ALPI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alkaline Phosphatase, Intestinal (ALPI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Alkaline Phosphatase, Intestinal (ALPI) ELISA Kit

SEB085Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Alkaline Phosphatase, Intestinal (ALPI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Alkaline Phosphatase, Intestinal (ALPI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

New World Rogas species exhibit a novel venom apparatus and might not be intently related to the Old World ones. Features of the venom apparatus of the enigmatic genus Telengaia and the exothecine genera Shawiana and Colastes counsel that the Telengainae and Exothecinae are each intently related to the Braconinae, Gnamptodontinae, and presumably to the Opiinae and Alysiinae. An unsculptured venom reservoir was discovered in one specimen of the kind species of AvgaA. choaspes, which is in line with it occupying both a really basal place inside the cyclostome braconids or belonging to a not too long ago acknowledged ‘Gondwanan’ clade that additionally consists of the Aphidiinae.

Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa.
Comparative morphology of the venom apparatus in the braconid wasp subfamily Rogadinae (Insecta, Hymenoptera, Braconidae) and related taxa.

Discovery of Raphidioptera (Insecta: Neuropterida) in Xizang, China, with description of a brand new species of Inocellia Schneider.

The holometabolous order Raphidioptera is recorded from Xizang Autonomous Region for the first time. A brand new species of the household Inocelliidae, Inocellia tibetana sp. nov., from southeastern Xizang is described and its two sexes illustrated.

Based on the male gonocoxite 9 that’s longer than width of its base, the new species belongs to the I. fulvostigmata species-group, and it seems to be intently related to I. fulvostigmata U. Aspöck, Rausch H.

Aspöck, 1968. Both species are distributed close to the southern edge of the Himalayas. The male of the new species is characterised in the genitalia by the presence of a membranous, quick and digitiform gonostylus 9, the gonarcus (fused gonocoxites 11) subtriangular in caudal view dorsally with a pair of quick tubercular processes, and the discount of bristle tuft on the endophallus.

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top