DMD Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

Human Dystrophin (DMD) ELISA Kit

RDR-DMD-Hu-96Tests 96 Tests
EUR 724

Mouse Dystrophin (DMD) ELISA Kit

RDR-DMD-Mu-48Tests 48 Tests
EUR 534

Mouse Dystrophin (DMD) ELISA Kit

RDR-DMD-Mu-96Tests 96 Tests
EUR 742

Human Dystrophin (DMD) ELISA Kit

RD-DMD-Hu-48Tests 48 Tests
EUR 500

Human Dystrophin (DMD) ELISA Kit

RD-DMD-Hu-96Tests 96 Tests
EUR 692

Mouse Dystrophin (DMD) ELISA Kit

RD-DMD-Mu-48Tests 48 Tests
EUR 511

Mouse Dystrophin (DMD) ELISA Kit

RD-DMD-Mu-96Tests 96 Tests
EUR 709

DMD Polyclonal Antibody

ABP58391-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DMD protein
  • Applications tips:
Description: A polyclonal antibody for detection of DMD from Human, Mouse, Rat. This DMD antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMD protein

DMD Polyclonal Antibody

ABP58391-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DMD protein
  • Applications tips:
Description: A polyclonal antibody for detection of DMD from Human, Mouse, Rat. This DMD antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMD protein

DMD Polyclonal Antibody

ABP58391-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DMD protein
  • Applications tips:
Description: A polyclonal antibody for detection of DMD from Human, Mouse, Rat. This DMD antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMD protein

DMD Polyclonal Antibody

ES9017-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DMD from Human/Mouse/Rat. This antibody is tested and validated for IHC

DMD Polyclonal Antibody

ES9017-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DMD from Human/Mouse/Rat. This antibody is tested and validated for IHC

DMD Rabbit pAb

A1411-100ul 100 ul
EUR 308

DMD Rabbit pAb

A1411-200ul 200 ul
EUR 459

DMD Rabbit pAb

A1411-20ul 20 ul
EUR 183

DMD Rabbit pAb

A1411-50ul 50 ul
EUR 223

Polyclonal DMD / Dystrophin Antibody

APR11762G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DMD / Dystrophin . This antibody is tested and proven to work in the following applications:

Rabbit DMD ELISA Kit

ERTD0036 96Tests
EUR 521

Dystrophin (DMD) Polyclonal Antibody (Human)

4-PAB503Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD)

Dystrophin (DMD) Polyclonal Antibody (Mouse)

4-PAB503Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD)

DMD antibody

70R-16862 50 ul
EUR 435
Description: Rabbit polyclonal DMD antibody

DMD Antibody

36428-100ul 100ul
EUR 252

DMD Antibody

1-CSB-PA503789
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DMD. Recognizes DMD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

DMD Antibody

1-CSB-PA006963GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DMD Antibody

1-CSB-PA006963LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Dystrophin (DMD) Polyclonal Antibody (Human), APC

4-PAB503Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with APC.

Dystrophin (DMD) Polyclonal Antibody (Human), Biotinylated

4-PAB503Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with Biotin.

Dystrophin (DMD) Polyclonal Antibody (Human), Cy3

4-PAB503Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with Cy3.

Dystrophin (DMD) Polyclonal Antibody (Human), FITC

4-PAB503Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with FITC.

Dystrophin (DMD) Polyclonal Antibody (Human), HRP

4-PAB503Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with HRP.

Dystrophin (DMD) Polyclonal Antibody (Human), PE

4-PAB503Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with PE.

Dystrophin (DMD) Polyclonal Antibody (Mouse), APC

4-PAB503Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with APC.

Dystrophin (DMD) Polyclonal Antibody (Mouse), Biotinylated

4-PAB503Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with Biotin.

Dystrophin (DMD) Polyclonal Antibody (Mouse), Cy3

4-PAB503Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with Cy3.

Dystrophin (DMD) Polyclonal Antibody (Mouse), FITC

4-PAB503Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with FITC.

Dystrophin (DMD) Polyclonal Antibody (Mouse), HRP

4-PAB503Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with HRP.

Dystrophin (DMD) Polyclonal Antibody (Mouse), PE

4-PAB503Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with PE.

Rabbit Dystrophin (DMD) ELISA Kit

abx355333-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Dystrophin (DMD) Antibody

20-abx176215
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dystrophin (DMD) Antibody

20-abx211560
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystrophin (DMD) Antibody

20-abx100315
  • EUR 328.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dystrophin (DMD) Antibody

20-abx100316
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dystrophin (DMD) Antibody

20-abx112214
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystrophin (DMD) Antibody

20-abx149852
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dystrophin (DMD) Antibody

20-abx172180
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

DMD Conjugated Antibody

C36428 100ul
EUR 397

Dystrophin (DMD) Antibody

abx232423-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Dystrophin (DMD) Antibody

20-abx001224
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti- DMD antibody

FNab02423 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • IHC: 1:50-1:500
  • IF: 1:20-1:200
  • Immunogen: dystrophin
  • Uniprot ID: P11532
  • Gene ID: 1756
  • Research Area: Neuroscience, Stem Cells, Signal Transduction
Description: Antibody raised against DMD

Anti-DMD antibody

PAab02423 100 ug
EUR 355

Anti-DMD antibody

STJ23394 100 µl
EUR 277
Description: This gene spans a genomic range of greater than 2 Mb and encodes a large protein containing an N-terminal actin-binding domain and multiple spectrin repeats. The encoded protein forms a component of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extracellular matrix. Deletions, duplications, and point mutations at this gene locus may cause Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or cardiomyopathy. Alternative promoter usage and alternative splicing result in numerous distinct transcript variants and protein isoforms for this gene.

Anti-DMD antibody

STJ190175 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DMD

Dystrophin (DMD) Polyclonal Antibody (Human), APC-Cy7

4-PAB503Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with APC-Cy7.

Dystrophin (DMD) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB503Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with APC-Cy7.

DMD siRNA

20-abx914266
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DMD siRNA

20-abx914267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DMD Antibody, HRP conjugated

1-CSB-PA006963LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DMD Antibody, FITC conjugated

1-CSB-PA006963LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DMD Antibody, Biotin conjugated

1-CSB-PA006963LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Dystrophin/DMD Antibody

PB9276 100ug/vial
EUR 334

DMD cloning plasmid

CSB-CL006963HU-10ug 10ug
EUR 644
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1908
  • Sequence: atgagggaacagctcaaaggccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgt
  • Show more
Description: A cloning plasmid for the DMD gene.

Recombinant Dystrophin (DMD)

4-RPB503Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11532
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dystrophin expressed in: E.coli

Recombinant Dystrophin (DMD)

4-RPB503Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11531
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Dystrophin expressed in: E.coli

Human Dystrophin (DMD) Protein

20-abx066369
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Dystrophin (DMD) Protein

20-abx066370
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human DMD ELISA Kit

EHD0036 96Tests
EUR 521

Human DMD ELISA Kit

ELA-E1503h 96 Tests
EUR 824

Goat DMD ELISA Kit

EGTD0036 96Tests
EUR 521

Bovine DMD ELISA Kit

EBD0036 96Tests
EUR 521

Canine DMD ELISA Kit

ECD0036 96Tests
EUR 521

Chicken DMD ELISA Kit

ECKD0036 96Tests
EUR 521

Anserini DMD ELISA Kit

EAD0036 96Tests
EUR 521

DMD ELISA KIT|Human

EF005868 96 Tests
EUR 689

Mouse DMD shRNA Plasmid

20-abx970021
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DMD shRNA Plasmid

20-abx951219
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DMD ELISA Kit

EMD0036 96Tests
EUR 521

Rat DMD ELISA Kit

ERD0036 96Tests
EUR 521

Sheep DMD ELISA Kit

ESD0036 96Tests
EUR 521

Monkey DMD ELISA Kit

EMKD0036 96Tests
EUR 521

Porcine DMD ELISA Kit

EPD0036 96Tests
EUR 521

Dog DMD/ Dystrophin ELISA Kit

E0031Do 1 Kit
EUR 717

Rat Dmd/ Dystrophin ELISA Kit

E0300Ra 1 Kit
EUR 571

Mouse Dmd/ Dystrophin ELISA Kit

E0409Mo 1 Kit
EUR 571

Human Dystrophin (DMD) CLIA Kit

abx196619-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

 

Scroll to Top