DYRK3 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

DYRK3 Polyclonal Antibody
ABP58442-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80 Applications tips:
Description: A polyclonal antibody for detection of DYRK3 from Human, Mouse, Rat. This DYRK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80

DYRK3 Polyclonal Antibody
ABP58442-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80 Applications tips:
Description: A polyclonal antibody for detection of DYRK3 from Human, Mouse, Rat. This DYRK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80

DYRK3 Polyclonal Antibody
ABP58442-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80 Applications tips:
Description: A polyclonal antibody for detection of DYRK3 from Human, Mouse, Rat. This DYRK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80

DYRK3 Polyclonal Antibody
A62450	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

DYRK3 Antibody
ABD8760	Lifescience Market	100 ug	EUR 438

Dyrk3 antibody
22581-100ul	SAB	100ul	EUR 390

Dyrk3 antibody
70R-13121	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal Dyrk3 antibody

DYRK3 Antibody
DF8760	Affbiotech	200ul	EUR 304
Description: DYRK3 Antibody detects endogenous levels of total DYRK3.

DYRK3 Antibody
1-CSB-PA007312LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:50-1:200

Polyclonal DYRK3 Antibody (N-term)
APR05926G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 (N-term). This antibody is tested and proven to work in the following applications:

DYRK3 Polyclonal Antibody, HRP Conjugated
A62451	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

DYRK3 Polyclonal Antibody, FITC Conjugated
A62452	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

DYRK3 Polyclonal Antibody, Biotin Conjugated
A62453	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Dyrk3/ Rat Dyrk3 ELISA Kit
ELI-32432r	Lifescience Market	96 Tests	EUR 886

Polyclonal DYRK3 antibody - N-terminal region
APR00549G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 - N-terminal region. This antibody is tested and proven to work in the following applications:

DYRK3 Antibody (HRP)
20-abx303689	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DYRK3 Antibody (FITC)
20-abx303690	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DYRK3 Antibody (Biotin)
20-abx303691	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-DYRK3 antibody
STJ190184	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK3

DYRK3 siRNA
20-abx901619	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DYRK3 siRNA
20-abx914831	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DYRK3 siRNA
20-abx914832	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DYRK3 Antibody, HRP conjugated
1-CSB-PA007312LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYRK3 Antibody, FITC conjugated
1-CSB-PA007312LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYRK3 Antibody, Biotin conjugated
1-CSB-PA007312LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DYRK3 cloning plasmid
CSB-CL007312HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1707 Sequence: atgaagtggaaagagaagttgggggatggtgtctatgacaccttcatgatgatagatgaaaccaaatgtcccccctgttcaaatgtactctgcaatccttctgaaccacctccacccagaagactaaatatgaccactgagcagtttacaggagatcatactcagcactttttgg Show more
Description: A cloning plasmid for the DYRK3 gene.

DYRK3 Blocking Peptide
DF8760-BP	Affbiotech	1mg	EUR 195

Anti-DYRK3 (3E10)
YF-MA11063	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DYRK3

Mouse DYRK3 shRNA Plasmid
20-abx981488	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat DYRK3 shRNA Plasmid
20-abx989287	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Dyrk3 ELISA KIT
ELI-09352m	Lifescience Market	96 Tests	EUR 865

Human DYRK3 ELISA KIT
ELI-31567h	Lifescience Market	96 Tests	EUR 824

Human DYRK3 shRNA Plasmid
20-abx955532	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DYRK3 ORF Vector (Human) (pORF)
ORF003352	ABM	1.0 ug DNA	EUR 95

Dyrk3 ORF Vector (Rat) (pORF)
ORF066307	ABM	1.0 ug DNA	EUR 506

Dyrk3 ORF Vector (Mouse) (pORF)
ORF043493	ABM	1.0 ug DNA	EUR 506

DYRK3 sgRNA CRISPR Lentivector set (Human)
K0645301	ABM	3 x 1.0 ug	EUR 339

Dyrk3 sgRNA CRISPR Lentivector set (Mouse)
K4482401	ABM	3 x 1.0 ug	EUR 339

Dyrk3 sgRNA CRISPR Lentivector set (Rat)
K6244801	ABM	3 x 1.0 ug	EUR 339

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody
abx033458-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody
abx033458-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody
20-abx303688	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DYRK3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0645302	ABM	1.0 ug DNA	EUR 154

DYRK3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0645303	ABM	1.0 ug DNA	EUR 154

DYRK3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0645304	ABM	1.0 ug DNA	EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4482402	ABM	1.0 ug DNA	EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4482403	ABM	1.0 ug DNA	EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4482404	ABM	1.0 ug DNA	EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6244802	ABM	1.0 ug DNA	EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6244803	ABM	1.0 ug DNA	EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6244804	ABM	1.0 ug DNA	EUR 154

DYRK3 Protein Vector (Mouse) (pPB-C-His)
PV173970	ABM	500 ng	EUR 603

DYRK3 Protein Vector (Mouse) (pPB-N-His)
PV173971	ABM	500 ng	EUR 603

DYRK3 Protein Vector (Mouse) (pPM-C-HA)
PV173972	ABM	500 ng	EUR 603

DYRK3 Protein Vector (Mouse) (pPM-C-His)
PV173973	ABM	500 ng	EUR 603

DYRK3 Protein Vector (Human) (pPB-C-His)
PV013405	ABM	500 ng	EUR 329

DYRK3 Protein Vector (Human) (pPB-N-His)
PV013406	ABM	500 ng	EUR 329

DYRK3 Protein Vector (Human) (pPM-C-HA)
PV013407	ABM	500 ng	EUR 329

DYRK3 Protein Vector (Human) (pPM-C-His)
PV013408	ABM	500 ng	EUR 329

DYRK3 Protein Vector (Rat) (pPB-C-His)
PV265226	ABM	500 ng	EUR 603

DYRK3 Protein Vector (Rat) (pPB-N-His)
PV265227	ABM	500 ng	EUR 603

DYRK3 Protein Vector (Rat) (pPM-C-HA)
PV265228	ABM	500 ng	EUR 603

DYRK3 Protein Vector (Rat) (pPM-C-His)
PV265229	ABM	500 ng	EUR 603

Dyrk3 3'UTR Luciferase Stable Cell Line
TU203726	ABM	1.0 ml	Ask for price

Dyrk3 3'UTR GFP Stable Cell Line
TU155499	ABM	1.0 ml	Ask for price

DYRK3 3'UTR Luciferase Stable Cell Line
TU006474	ABM	1.0 ml	EUR 1394

Dyrk3 3'UTR Luciferase Stable Cell Line
TU105499	ABM	1.0 ml	Ask for price

DYRK3 3'UTR GFP Stable Cell Line
TU056474	ABM	1.0 ml	EUR 1394

Dyrk3 3'UTR GFP Stable Cell Line
TU253726	ABM	1.0 ml	Ask for price

DYRK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV667165	ABM	1.0 ug DNA	EUR 682

DYRK3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV667169	ABM	1.0 ug DNA	EUR 682

DYRK3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV667170	ABM	1.0 ug DNA	EUR 682

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC