DYRK3 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

DYRK3 Polyclonal Antibody

ABP58442-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK3 from Human, Mouse, Rat. This DYRK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80

DYRK3 Polyclonal Antibody

ABP58442-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK3 from Human, Mouse, Rat. This DYRK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80

DYRK3 Polyclonal Antibody

ABP58442-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK3 from Human, Mouse, Rat. This DYRK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK3 protein at amino acid sequence of 1-80

DYRK3 Polyclonal Antibody

A62450 100 µg
EUR 570.55
Description: Ask the seller for details

DYRK3 Antibody

ABD8760 100 ug
EUR 438

Dyrk3 antibody

22581-100ul 100ul
EUR 390

Dyrk3 antibody

70R-13121 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal Dyrk3 antibody

DYRK3 Antibody

DF8760 200ul
EUR 304
Description: DYRK3 Antibody detects endogenous levels of total DYRK3.

DYRK3 Antibody

1-CSB-PA007312LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:50-1:200

Polyclonal DYRK3 Antibody (N-term)

APR05926G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 (N-term). This antibody is tested and proven to work in the following applications:

DYRK3 Polyclonal Antibody, HRP Conjugated

A62451 100 µg
EUR 570.55
Description: The best epigenetics products

DYRK3 Polyclonal Antibody, FITC Conjugated

A62452 100 µg
EUR 570.55
Description: kits suitable for this type of research

DYRK3 Polyclonal Antibody, Biotin Conjugated

A62453 100 µg
EUR 570.55
Description: fast delivery possible

Dyrk3/ Rat Dyrk3 ELISA Kit

ELI-32432r 96 Tests
EUR 886

Polyclonal DYRK3 antibody - N-terminal region

APR00549G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK3 - N-terminal region. This antibody is tested and proven to work in the following applications:

DYRK3 Antibody (HRP)

20-abx303689
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DYRK3 Antibody (FITC)

20-abx303690
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DYRK3 Antibody (Biotin)

20-abx303691
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-DYRK3 antibody

STJ190184 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK3

DYRK3 siRNA

20-abx901619
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYRK3 siRNA

20-abx914831
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYRK3 siRNA

20-abx914832
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYRK3 Antibody, HRP conjugated

1-CSB-PA007312LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYRK3 Antibody, FITC conjugated

1-CSB-PA007312LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYRK3 Antibody, Biotin conjugated

1-CSB-PA007312LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYRK3. Recognizes DYRK3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DYRK3 cloning plasmid

CSB-CL007312HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1707
  • Sequence: atgaagtggaaagagaagttgggggatggtgtctatgacaccttcatgatgatagatgaaaccaaatgtcccccctgttcaaatgtactctgcaatccttctgaaccacctccacccagaagactaaatatgaccactgagcagtttacaggagatcatactcagcactttttgg
  • Show more
Description: A cloning plasmid for the DYRK3 gene.

DYRK3 Blocking Peptide

DF8760-BP 1mg
EUR 195

Anti-DYRK3 (3E10)

YF-MA11063 100 ug
EUR 363
Description: Mouse monoclonal to DYRK3

Mouse DYRK3 shRNA Plasmid

20-abx981488
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DYRK3 shRNA Plasmid

20-abx989287
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Dyrk3 ELISA KIT

ELI-09352m 96 Tests
EUR 865

Human DYRK3 ELISA KIT

ELI-31567h 96 Tests
EUR 824

Human DYRK3 shRNA Plasmid

20-abx955532
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DYRK3 ORF Vector (Human) (pORF)

ORF003352 1.0 ug DNA
EUR 95

Dyrk3 ORF Vector (Rat) (pORF)

ORF066307 1.0 ug DNA
EUR 506

Dyrk3 ORF Vector (Mouse) (pORF)

ORF043493 1.0 ug DNA
EUR 506

DYRK3 sgRNA CRISPR Lentivector set (Human)

K0645301 3 x 1.0 ug
EUR 339

Dyrk3 sgRNA CRISPR Lentivector set (Mouse)

K4482401 3 x 1.0 ug
EUR 339

Dyrk3 sgRNA CRISPR Lentivector set (Rat)

K6244801 3 x 1.0 ug
EUR 339

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody

abx033458-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody

abx033458-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dual Specificity Tyrosine-Phosphorylation-Regulated Kinase 3 (DYRK3) Antibody

20-abx303688
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DYRK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0645302 1.0 ug DNA
EUR 154

DYRK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0645303 1.0 ug DNA
EUR 154

DYRK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0645304 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4482402 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4482403 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4482404 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6244802 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6244803 1.0 ug DNA
EUR 154

Dyrk3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6244804 1.0 ug DNA
EUR 154

DYRK3 Protein Vector (Mouse) (pPB-C-His)

PV173970 500 ng
EUR 603

DYRK3 Protein Vector (Mouse) (pPB-N-His)

PV173971 500 ng
EUR 603

DYRK3 Protein Vector (Mouse) (pPM-C-HA)

PV173972 500 ng
EUR 603

DYRK3 Protein Vector (Mouse) (pPM-C-His)

PV173973 500 ng
EUR 603

DYRK3 Protein Vector (Human) (pPB-C-His)

PV013405 500 ng
EUR 329

DYRK3 Protein Vector (Human) (pPB-N-His)

PV013406 500 ng
EUR 329

DYRK3 Protein Vector (Human) (pPM-C-HA)

PV013407 500 ng
EUR 329

DYRK3 Protein Vector (Human) (pPM-C-His)

PV013408 500 ng
EUR 329

DYRK3 Protein Vector (Rat) (pPB-C-His)

PV265226 500 ng
EUR 603

DYRK3 Protein Vector (Rat) (pPB-N-His)

PV265227 500 ng
EUR 603

DYRK3 Protein Vector (Rat) (pPM-C-HA)

PV265228 500 ng
EUR 603

DYRK3 Protein Vector (Rat) (pPM-C-His)

PV265229 500 ng
EUR 603

Dyrk3 3'UTR Luciferase Stable Cell Line

TU203726 1.0 ml Ask for price

Dyrk3 3'UTR GFP Stable Cell Line

TU155499 1.0 ml Ask for price

DYRK3 3'UTR Luciferase Stable Cell Line

TU006474 1.0 ml
EUR 1394

Dyrk3 3'UTR Luciferase Stable Cell Line

TU105499 1.0 ml Ask for price

DYRK3 3'UTR GFP Stable Cell Line

TU056474 1.0 ml
EUR 1394

Dyrk3 3'UTR GFP Stable Cell Line

TU253726 1.0 ml Ask for price

DYRK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV667165 1.0 ug DNA
EUR 682

DYRK3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV667169 1.0 ug DNA
EUR 682

DYRK3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV667170 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

 

Scroll to Top