EYA1/EYA4 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

EYA1/EYA4 Polyclonal Antibody

ABP58510-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EYA1/EYA4 protein at amino acid sequence of 271-320
  • Applications tips:
Description: A polyclonal antibody for detection of EYA1/EYA4 from Human, Mouse. This EYA1/EYA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EYA1/EYA4 protein at amino acid sequence of 271-320

EYA1/EYA4 Polyclonal Antibody

ABP58510-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EYA1/EYA4 protein at amino acid sequence of 271-320
  • Applications tips:
Description: A polyclonal antibody for detection of EYA1/EYA4 from Human, Mouse. This EYA1/EYA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EYA1/EYA4 protein at amino acid sequence of 271-320

EYA1 / EYA4 Antibody

20-abx325358
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EYA1/EYA4 Antibody

1-CSB-PA109941
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against EYA1/EYA4. Recognizes EYA1/EYA4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

Anti-EYA1/EYA4 antibody

STJ99013 200 µl
EUR 197
Description: Rabbit polyclonal to EYA1/EYA4.

EYA4 Polyclonal Antibody

A69491 100 ?g
EUR 628.55
Description: The best epigenetics products

EYA4 Polyclonal Antibody

31726-100ul 100ul
EUR 252

EYA4 Polyclonal Antibody

31726-50ul 50ul
EUR 187

EYA1 Polyclonal Antibody

A69151 100 ?g
EUR 628.55
Description: reagents widely cited

EYA1 Polyclonal Antibody

31720-100ul 100ul
EUR 252

EYA1 Polyclonal Antibody

31720-50ul 50ul
EUR 187

EYA4 Rabbit pAb

A9638-100ul 100 ul
EUR 308

EYA4 Rabbit pAb

A9638-200ul 200 ul
EUR 459

EYA4 Rabbit pAb

A9638-20ul 20 ul Ask for price

EYA4 Rabbit pAb

A9638-50ul 50 ul Ask for price

EYA4 Polyclonal Conjugated Antibody

C31726 100ul
EUR 397

EYA1 Rabbit pAb

A9534-100ul 100 ul
EUR 308

EYA1 Rabbit pAb

A9534-200ul 200 ul
EUR 459

EYA1 Rabbit pAb

A9534-20ul 20 ul
EUR 183

EYA1 Rabbit pAb

A9534-50ul 50 ul
EUR 223

EYA1 Polyclonal Conjugated Antibody

C31720 100ul
EUR 397

EYA4 Antibody

1-CSB-PA007909LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EYA4. Recognizes EYA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:200-1:500

EYA1 Antibody

1-CSB-PA857862LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EYA1. Recognizes EYA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:50-1:200

Polyclonal EYA4 Antibody (C-term)

APR11886G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EYA4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal EYA4 Antibody (N-Term)

APR11887G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EYA4 (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal EYA4 Antibody (N-Terminus)

APR11888G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EYA4 (N-Terminus). This antibody is tested and proven to work in the following applications:

EYA4 Polyclonal Antibody, HRP Conjugated

A69492 100 ?g
EUR 628.55
Description: kits suitable for this type of research

EYA4 Polyclonal Antibody, FITC Conjugated

A69493 100 ?g
EUR 628.55
Description: fast delivery possible

EYA4 Polyclonal Antibody, Biotin Conjugated

A69494 100 ?g
EUR 628.55
Description: reagents widely cited

Polyclonal EYA1 antibody - middle region

APR00561G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EYA1 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-EYA1 Antibody

APG00375G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-EYA1 . This antibody is tested and proven to work in the following applications:

EYA1 Polyclonal Antibody, HRP Conjugated

A69152 100 ?g
EUR 628.55
Description: Ask the seller for details

EYA1 Polyclonal Antibody, FITC Conjugated

A69153 100 ?g
EUR 628.55
Description: The best epigenetics products

EYA1 Polyclonal Antibody, Biotin Conjugated

A69154 100 ?g
EUR 628.55
Description: kits suitable for this type of research

anti- EYA4 antibody

FNab02916 100µg
EUR 585
  • Immunogen: eyes absent homolog 4(Drosophila)
  • Uniprot ID: O95677
  • Gene ID: 2070
  • Research Area: Neuroscience, Cardiovascular, Metabolism, Developmental biology
Description: Antibody raised against EYA4

Anti-EYA4 antibody

PAab02916 100 ug
EUR 412

Anti-EYA4 antibody

STJ70809 100 µg
EUR 359

Anti-EYA4 antibody

STJ111772 100 µl
EUR 277
Description: This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

anti- EYA1 antibody

FNab02913 100µg
EUR 585
  • Immunogen: eyes absent homolog 1(Drosophila)
  • Uniprot ID: Q99502
  • Gene ID: 2138
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against EYA1

Anti-EYA1 antibody

PAab02913 100 ug
EUR 412

Anti-EYA1 antibody

STJ72082 100 µg
EUR 359

Anti-EYA1 antibody

STJ113653 100 µl
EUR 277
Description: This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene.

EYA4 siRNA

20-abx915852
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EYA4 siRNA

20-abx915853
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EYA1 siRNA

20-abx915846
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EYA1 siRNA

20-abx915847
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-EYA1

YF-PA23680 50 ul
EUR 334
Description: Mouse polyclonal to EYA1

EYA4 Antibody, HRP conjugated

1-CSB-PA007909LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EYA4. Recognizes EYA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EYA4 Antibody, FITC conjugated

1-CSB-PA007909LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EYA4. Recognizes EYA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EYA4 Antibody, Biotin conjugated

1-CSB-PA007909LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EYA4. Recognizes EYA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EYA1 Antibody, HRP conjugated

1-CSB-PA857862LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EYA1. Recognizes EYA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EYA1 Antibody, FITC conjugated

1-CSB-PA857862LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EYA1. Recognizes EYA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EYA1 Antibody, Biotin conjugated

1-CSB-PA857862LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EYA1. Recognizes EYA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EYA4 cloning plasmid

CSB-CL007909HU-10ug 10ug
EUR 628
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1851
  • Sequence: atggaagactcccaggatttaaatgaacaatcagtaaagaaaacgtgcacagaatcagatgtttcacaatctcagaattccaggtctatggaaatgcaggacctagcaagtcctcatactcttgttggaggtggtgatactccaggtagctccaaactggaaaaatctaatctca
  • Show more
Description: A cloning plasmid for the EYA4 gene.

EYA1 Blocking Peptide

20-abx161092
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EYA1 cloning plasmid

CSB-CL857862HU-10ug 10ug
EUR 608
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1779
  • Sequence: ATGGAAATGCAGGATCTAACCAGCCCGCATAGCCGTCTGAGTGGTAGTAGTGAATCCCCCAGTGGCCCCAAACTCGGTAACTCTCATATAAATAGTAATTCCATGACTCCCAATGGCACCGAAGTTAAAACAGAGCCAATGAGCAGCAGTGAAACAGCTTCAACGACAGCCGACG
  • Show more
Description: A cloning plasmid for the EYA1 gene.

Rabbit Anti-Human eyes absent homolog 1 (EYA1) (EYA1- symmetric dimethyl arginine) IgG (aff pure)

AB-23020-A 100 ug
EUR 482

Rabbit Anti-Human eyes absent homolog 1 (EYA1) (EYA1- symmetric dimethyl arginine) IgG (aff pure)

AB-23021-A 100 ug
EUR 482

 

Scroll to Top