FA2H Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

FA2H Polyclonal Antibody

ABP58517-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FA2H protein at amino acid sequence of 101-150
  • Applications tips:
Description: A polyclonal antibody for detection of FA2H from Human, Mouse, Rat. This FA2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FA2H protein at amino acid sequence of 101-150

FA2H Polyclonal Antibody

ES8847-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FA2H from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FA2H Polyclonal Antibody

ES8847-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FA2H from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FA2H Rabbit pAb

A13873-100ul 100 ul
EUR 308

FA2H Rabbit pAb

A13873-200ul 200 ul
EUR 459

FA2H Rabbit pAb

A13873-20ul 20 ul
EUR 183

FA2H Rabbit pAb

A13873-50ul 50 ul
EUR 223

FA2H Rabbit pAb

A13874-100ul 100 ul
EUR 308

FA2H Rabbit pAb

A13874-200ul 200 ul
EUR 459

FA2H Rabbit pAb

A13874-20ul 20 ul
EUR 183

FA2H Rabbit pAb

A13874-50ul 50 ul
EUR 223

FA2H Polyclonal Conjugated Antibody

C46899 100ul
EUR 397

FA2H antibody

70R-17188 50 ul
EUR 435
Description: Rabbit polyclonal FA2H antibody

FA2H Antibody

DF12995 200ul
EUR 304
Description: FA2H Antibody detects endogenous levels of FA2H.

FA2H Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FA2H. Recognizes FA2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

Fa2h antibody

70R-7969 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fa2h antibody

FA2H Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FA2H. Recognizes FA2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal Fa2h antibody - C-terminal region

APR11890G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fa2h - C-terminal region. This antibody is tested and proven to work in the following applications:

anti- FA2H antibody

FNab02926 100µg
EUR 505.25
  • Immunogen: fatty acid 2-hydroxylase
  • Uniprot ID: Q7L5A8
  • Gene ID: 79152
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against FA2H

Anti-FA2H antibody

PAab02926 100 ug
EUR 355

Anti-FA2H antibody

STJ115812 100 µl
EUR 277
Description: This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.

Anti-FA2H antibody

STJ115813 100 µl
EUR 277
Description: This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.

Anti-FA2H antibody

STJ99320 200 µl
EUR 197
Description: Rabbit polyclonal to FA2H.

Fa2h/ Rat Fa2h ELISA Kit

ELI-32789r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA20765 50 ug
EUR 363
Description: Mouse polyclonal to FA2H

Fa2h Blocking Peptide

33R-3743 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fa2h antibody, catalog no. 70R-7969

FA2H Blocking Peptide

DF12995-BP 1mg
EUR 195

FA2H cloning plasmid

CSB-CL007937HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atggagaacgagcctgtagcccttgaggaaactcagaagacagatcctgctatggaaccacggttcaaagtggtggattgggacaaggacctggtggactggcgaaagcctctcctgtggcaggtgggccacttgggagagaagtacgatgagtgggttcaccagccggtgaccag
  • Show more
Description: A cloning plasmid for the FA2H gene.

FA2H cloning plasmid

CSB-CL007937HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atggagaacgagcctgtagcccttgaggaaactcagaagacagatcctgctatggaaccacggttcaaagtggtggattgggacaaggacctggtggactggcgaaagcctctcctgtggcaggtgggccacttgggagagaagtacgatgagtgggttcaccagccggtgaccag
  • Show more
Description: A cloning plasmid for the FA2H gene.

FA2H cloning plasmid

CSB-CL007937HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 357
  • Sequence: atgcccaagcctctccatctgcaggcacccttcgacggctcccgcctggtcttcccccctgtgccagcctccctggtgatcggcgtcttctacttgtgcatgcagctcatcctgcctgaggcagtagggggcactgtgtttgcggggggcctcctgggctacgtcctctatgacat
  • Show more
Description: A cloning plasmid for the FA2H gene.


PVT13971 2 ug
EUR 391


EF009496 96 Tests
EUR 689

Rat FA2H shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FA2H shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FA2H shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FA2H Recombinant Protein (Human)

RP011140 100 ug Ask for price

FA2H Recombinant Protein (Human)

RP011143 100 ug Ask for price

FA2H Recombinant Protein (Human)

RP011146 100 ug Ask for price

FA2H Recombinant Protein (Rat)

RP200216 100 ug Ask for price

FA2H Recombinant Protein (Mouse)

RP132674 100 ug Ask for price

Fatty Acid 2-Hydroxylase (FA2H) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fatty Acid 2-Hydroxylase (FA2H) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fatty Acid 2-Hydroxylase (FA2H) Antibody

abx232926-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fa2h ORF Vector (Rat) (pORF)

ORF066740 1.0 ug DNA
EUR 506

FA2H ORF Vector (Human) (pORF)

ORF003714 1.0 ug DNA
EUR 95

FA2H ORF Vector (Human) (pORF)

ORF003715 1.0 ug DNA
EUR 95

FA2H ORF Vector (Human) (pORF)

ORF003716 1.0 ug DNA
EUR 95

Fa2h ORF Vector (Mouse) (pORF)

ORF044226 1.0 ug DNA
EUR 506

pECMV-Fa2h-m-FLAG Plasmid

PVT14983 2 ug
EUR 325

FA2H sgRNA CRISPR Lentivector set (Human)

K0708301 3 x 1.0 ug
EUR 339

Fa2h sgRNA CRISPR Lentivector set (Mouse)

K5027201 3 x 1.0 ug
EUR 339

Fa2h sgRNA CRISPR Lentivector set (Rat)

K6296401 3 x 1.0 ug
EUR 339

FA2H sgRNA CRISPR Lentivector (Human) (Target 1)

K0708302 1.0 ug DNA
EUR 154

FA2H sgRNA CRISPR Lentivector (Human) (Target 2)

K0708303 1.0 ug DNA
EUR 154

FA2H sgRNA CRISPR Lentivector (Human) (Target 3)

K0708304 1.0 ug DNA
EUR 154

Fa2h sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5027202 1.0 ug DNA
EUR 154

Fa2h sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5027203 1.0 ug DNA
EUR 154

Fa2h sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5027204 1.0 ug DNA
EUR 154

Fa2h sgRNA CRISPR Lentivector (Rat) (Target 1)

K6296402 1.0 ug DNA
EUR 154

Fa2h sgRNA CRISPR Lentivector (Rat) (Target 2)

K6296403 1.0 ug DNA
EUR 154

Fa2h sgRNA CRISPR Lentivector (Rat) (Target 3)

K6296404 1.0 ug DNA
EUR 154

FA2H Protein Vector (Mouse) (pPB-C-His)

PV176902 500 ng
EUR 603

FA2H Protein Vector (Mouse) (pPB-N-His)

PV176903 500 ng
EUR 603

FA2H Protein Vector (Mouse) (pPM-C-HA)

PV176904 500 ng
EUR 603

FA2H Protein Vector (Mouse) (pPM-C-His)

PV176905 500 ng
EUR 603

FA2H Protein Vector (Rat) (pPB-C-His)

PV266958 500 ng
EUR 603

FA2H Protein Vector (Rat) (pPB-N-His)

PV266959 500 ng
EUR 603

FA2H Protein Vector (Rat) (pPM-C-HA)

PV266960 500 ng
EUR 603

FA2H Protein Vector (Rat) (pPM-C-His)

PV266961 500 ng
EUR 603

FA2H Protein Vector (Human) (pPB-C-His)

PV014853 500 ng
EUR 329

FA2H Protein Vector (Human) (pPB-N-His)

PV014854 500 ng
EUR 329

FA2H Protein Vector (Human) (pPM-C-HA)

PV014855 500 ng
EUR 329

FA2H Protein Vector (Human) (pPM-C-His)

PV014856 500 ng
EUR 329

FA2H Protein Vector (Human) (pPB-C-His)

PV014857 500 ng
EUR 329

FA2H Protein Vector (Human) (pPB-N-His)

PV014858 500 ng
EUR 329

FA2H Protein Vector (Human) (pPM-C-HA)

PV014859 500 ng
EUR 329

FA2H Protein Vector (Human) (pPM-C-His)

PV014860 500 ng
EUR 329

FA2H Protein Vector (Human) (pPB-C-His)

PV014861 500 ng
EUR 329

FA2H Protein Vector (Human) (pPB-N-His)

PV014862 500 ng
EUR 329

FA2H Protein Vector (Human) (pPM-C-HA)

PV014863 500 ng
EUR 329

FA2H Protein Vector (Human) (pPM-C-His)

PV014864 500 ng
EUR 329

Fa2h 3'UTR GFP Stable Cell Line

TU156067 1.0 ml Ask for price

Fa2h 3'UTR Luciferase Stable Cell Line

TU106067 1.0 ml Ask for price

Fa2h 3'UTR Luciferase Stable Cell Line

TU204197 1.0 ml Ask for price

Fa2h 3'UTR GFP Stable Cell Line

TU254197 1.0 ml Ask for price

FA2H 3'UTR GFP Stable Cell Line

TU057178 1.0 ml
EUR 1394

FA2H 3'UTR Luciferase Stable Cell Line

TU007178 1.0 ml
EUR 1394

Human Fatty acid 2- hydroxylase, FA2H ELISA KIT

ELI-20611h 96 Tests
EUR 824

Rat Fatty Acid 2-Hydroxylase (FA2H) ELISA Kit

abx391316-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Fatty Acid 2-Hydroxylase (FA2H) ELISA Kit

abx387237-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Fatty Acid 2-Hydroxylase (FA2H) ELISA Kit

abx389254-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

FA2H Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709887 1.0 ug DNA
EUR 316

FA2H Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709891 1.0 ug DNA
EUR 316

FA2H Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV709892 1.0 ug DNA
EUR 316


Scroll to Top