FA2H Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

FA2H Polyclonal Antibody
ABP58517-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human FA2H protein at amino acid sequence of 101-150 Applications tips:
Description: A polyclonal antibody for detection of FA2H from Human, Mouse, Rat. This FA2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FA2H protein at amino acid sequence of 101-150

FA2H Polyclonal Antibody
ES8847-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FA2H from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FA2H Polyclonal Antibody
ES8847-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FA2H from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FA2H Rabbit pAb
A13873-100ul	Abclonal	100 ul	EUR 308

FA2H Rabbit pAb
A13873-200ul	Abclonal	200 ul	EUR 459

FA2H Rabbit pAb
A13873-20ul	Abclonal	20 ul	EUR 183

FA2H Rabbit pAb
A13873-50ul	Abclonal	50 ul	EUR 223

FA2H Rabbit pAb
A13874-100ul	Abclonal	100 ul	EUR 308

FA2H Rabbit pAb
A13874-200ul	Abclonal	200 ul	EUR 459

FA2H Rabbit pAb
A13874-20ul	Abclonal	20 ul	EUR 183

FA2H Rabbit pAb
A13874-50ul	Abclonal	50 ul	EUR 223

FA2H Polyclonal Conjugated Antibody
C46899	SAB	100ul	EUR 397

FA2H antibody
70R-17188	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FA2H antibody

FA2H Antibody
DF12995	Affbiotech	200ul	EUR 304
Description: FA2H Antibody detects endogenous levels of FA2H.

FA2H Antibody
1-CSB-PA316430	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FA2H. Recognizes FA2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

Fa2h antibody
70R-7969	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Fa2h antibody

FA2H Antibody
1-CSB-PA007937GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FA2H. Recognizes FA2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal Fa2h antibody - C-terminal region
APR11890G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fa2h - C-terminal region. This antibody is tested and proven to work in the following applications:

anti- FA2H antibody
FNab02926	FN Test	100µg	EUR 505.25
Immunogen: fatty acid 2-hydroxylase Uniprot ID: Q7L5A8 Gene ID: 79152 Research Area: Neuroscience, Metabolism
Description: Antibody raised against FA2H

Anti-FA2H antibody
PAab02926	Lifescience Market	100 ug	EUR 355

Anti-FA2H antibody
STJ115812	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.

Anti-FA2H antibody
STJ115813	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.

Anti-FA2H antibody
STJ99320	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to FA2H.

Fa2h/ Rat Fa2h ELISA Kit
ELI-32789r	Lifescience Market	96 Tests	EUR 886

FA2H siRNA
20-abx901812	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FA2H siRNA
20-abx915896	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FA2H siRNA
20-abx915897	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-FA2H
YF-PA20765	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FA2H

Fa2h Blocking Peptide
33R-3743	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fa2h antibody, catalog no. 70R-7969

FA2H Blocking Peptide
DF12995-BP	Affbiotech	1mg	EUR 195

FA2H cloning plasmid
CSB-CL007937HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 843 Sequence: atggagaacgagcctgtagcccttgaggaaactcagaagacagatcctgctatggaaccacggttcaaagtggtggattgggacaaggacctggtggactggcgaaagcctctcctgtggcaggtgggccacttgggagagaagtacgatgagtgggttcaccagccggtgaccag Show more
Description: A cloning plasmid for the FA2H gene.

FA2H cloning plasmid
CSB-CL007937HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 843 Sequence: atggagaacgagcctgtagcccttgaggaaactcagaagacagatcctgctatggaaccacggttcaaagtggtggattgggacaaggacctggtggactggcgaaagcctctcctgtggcaggtgggccacttgggagagaagtacgatgagtgggttcaccagccggtgaccag Show more
Description: A cloning plasmid for the FA2H gene.

FA2H cloning plasmid
CSB-CL007937HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 357 Sequence: atgcccaagcctctccatctgcaggcacccttcgacggctcccgcctggtcttcccccctgtgccagcctccctggtgatcggcgtcttctacttgtgcatgcagctcatcctgcctgaggcagtagggggcactgtgtttgcggggggcctcctgggctacgtcctctatgacat Show more
Description: A cloning plasmid for the FA2H gene.

pCMV-SPORT6-FA2H
PVT13971	Lifescience Market	2 ug	EUR 391

FA2H ELISA KIT|Human
EF009496	Lifescience Market	96 Tests	EUR 689

Rat FA2H shRNA Plasmid
20-abx989455	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse FA2H shRNA Plasmid
20-abx983700	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FA2H shRNA Plasmid
20-abx962330	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FA2H Recombinant Protein (Human)
RP011140	ABM	100 ug	Ask for price

FA2H Recombinant Protein (Human)
RP011143	ABM	100 ug	Ask for price

FA2H Recombinant Protein (Human)
RP011146	ABM	100 ug	Ask for price

FA2H Recombinant Protein (Rat)
RP200216	ABM	100 ug	Ask for price

FA2H Recombinant Protein (Mouse)
RP132674	ABM	100 ug	Ask for price

Fatty Acid 2-Hydroxylase (FA2H) Antibody
20-abx112477	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Fatty Acid 2-Hydroxylase (FA2H) Antibody
20-abx329806	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Fatty Acid 2-Hydroxylase (FA2H) Antibody
abx232926-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Fa2h ORF Vector (Rat) (pORF)
ORF066740	ABM	1.0 ug DNA	EUR 506

FA2H ORF Vector (Human) (pORF)
ORF003714	ABM	1.0 ug DNA	EUR 95

FA2H ORF Vector (Human) (pORF)
ORF003715	ABM	1.0 ug DNA	EUR 95

FA2H ORF Vector (Human) (pORF)
ORF003716	ABM	1.0 ug DNA	EUR 95

Fa2h ORF Vector (Mouse) (pORF)
ORF044226	ABM	1.0 ug DNA	EUR 506

pECMV-Fa2h-m-FLAG Plasmid
PVT14983	Lifescience Market	2 ug	EUR 325

FA2H sgRNA CRISPR Lentivector set (Human)
K0708301	ABM	3 x 1.0 ug	EUR 339

Fa2h sgRNA CRISPR Lentivector set (Mouse)
K5027201	ABM	3 x 1.0 ug	EUR 339

Fa2h sgRNA CRISPR Lentivector set (Rat)
K6296401	ABM	3 x 1.0 ug	EUR 339

FA2H sgRNA CRISPR Lentivector (Human) (Target 1)
K0708302	ABM	1.0 ug DNA	EUR 154

FA2H sgRNA CRISPR Lentivector (Human) (Target 2)
K0708303	ABM	1.0 ug DNA	EUR 154

FA2H sgRNA CRISPR Lentivector (Human) (Target 3)
K0708304	ABM	1.0 ug DNA	EUR 154

Fa2h sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5027202	ABM	1.0 ug DNA	EUR 154

Fa2h sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5027203	ABM	1.0 ug DNA	EUR 154

Fa2h sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5027204	ABM	1.0 ug DNA	EUR 154

Fa2h sgRNA CRISPR Lentivector (Rat) (Target 1)
K6296402	ABM	1.0 ug DNA	EUR 154

Fa2h sgRNA CRISPR Lentivector (Rat) (Target 2)
K6296403	ABM	1.0 ug DNA	EUR 154

Fa2h sgRNA CRISPR Lentivector (Rat) (Target 3)
K6296404	ABM	1.0 ug DNA	EUR 154

FA2H Protein Vector (Mouse) (pPB-C-His)
PV176902	ABM	500 ng	EUR 603

FA2H Protein Vector (Mouse) (pPB-N-His)
PV176903	ABM	500 ng	EUR 603

FA2H Protein Vector (Mouse) (pPM-C-HA)
PV176904	ABM	500 ng	EUR 603

FA2H Protein Vector (Mouse) (pPM-C-His)
PV176905	ABM	500 ng	EUR 603

FA2H Protein Vector (Rat) (pPB-C-His)
PV266958	ABM	500 ng	EUR 603

FA2H Protein Vector (Rat) (pPB-N-His)
PV266959	ABM	500 ng	EUR 603

FA2H Protein Vector (Rat) (pPM-C-HA)
PV266960	ABM	500 ng	EUR 603

FA2H Protein Vector (Rat) (pPM-C-His)
PV266961	ABM	500 ng	EUR 603

FA2H Protein Vector (Human) (pPB-C-His)
PV014853	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPB-N-His)
PV014854	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPM-C-HA)
PV014855	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPM-C-His)
PV014856	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPB-C-His)
PV014857	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPB-N-His)
PV014858	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPM-C-HA)
PV014859	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPM-C-His)
PV014860	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPB-C-His)
PV014861	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPB-N-His)
PV014862	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPM-C-HA)
PV014863	ABM	500 ng	EUR 329

FA2H Protein Vector (Human) (pPM-C-His)
PV014864	ABM	500 ng	EUR 329

Fa2h 3'UTR GFP Stable Cell Line
TU156067	ABM	1.0 ml	Ask for price

Fa2h 3'UTR Luciferase Stable Cell Line
TU106067	ABM	1.0 ml	Ask for price

Fa2h 3'UTR Luciferase Stable Cell Line
TU204197	ABM	1.0 ml	Ask for price

Fa2h 3'UTR GFP Stable Cell Line
TU254197	ABM	1.0 ml	Ask for price

FA2H 3'UTR GFP Stable Cell Line
TU057178	ABM	1.0 ml	EUR 1394

FA2H 3'UTR Luciferase Stable Cell Line
TU007178	ABM	1.0 ml	EUR 1394

Human Fatty acid 2- hydroxylase, FA2H ELISA KIT
ELI-20611h	Lifescience Market	96 Tests	EUR 824

Rat Fatty Acid 2-Hydroxylase (FA2H) ELISA Kit
abx391316-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Fatty Acid 2-Hydroxylase (FA2H) ELISA Kit
abx387237-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Fatty Acid 2-Hydroxylase (FA2H) ELISA Kit
abx389254-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

FA2H Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV709887	ABM	1.0 ug DNA	EUR 316

FA2H Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV709891	ABM	1.0 ug DNA	EUR 316

FA2H Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV709892	ABM	1.0 ug DNA	EUR 316