FHL3 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

FHL3 Rabbit pAb

A8679-100ul 100 ul
EUR 308

FHL3 Rabbit pAb

A8679-200ul 200 ul
EUR 459

FHL3 Rabbit pAb

A8679-20ul 20 ul
EUR 183

FHL3 Rabbit pAb

A8679-50ul 50 ul
EUR 223

FHL3 antibody

70R-17303 50 ul
EUR 435
Description: Rabbit polyclonal FHL3 antibody

FHL3 Antibody

36483-100ul 100ul
EUR 252

FHL3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FHL3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

FHL3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

FHL3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FHL3 Antibody

DF8826 200ul
EUR 304
Description: FHL3 Antibody detects endogenous levels of total FHL3.

FHL3 antibody

70R-49746 100 ul
EUR 244
Description: Purified Polyclonal FHL3 antibody

FHL3 antibody

70R-8913 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FHL3 antibody

FHL3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FHL3 Antibody

ABD8826 100 ug
EUR 438

Polyclonal Goat Anti-FHL3 / SLIM2 Antibody

APG00126G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FHL3 / SLIM2 . This antibody is tested and proven to work in the following applications:

FHL3 Conjugated Antibody

C36483 100ul
EUR 397

anti- FHL3 antibody

FNab03112 100µg
EUR 505.25
  • Immunogen: four and a half LIM domains 3
  • Uniprot ID: Q13643
  • Gene ID: 2275
  • Research Area: Developmental biology
Description: Antibody raised against FHL3

Anti-FHL3 antibody

PAab03112 100 ug
EUR 355

Anti-FHL3 Antibody

PB10064 100ug/vial
EUR 294

Anti-FHL3 antibody

STJ111377 100 µl
EUR 277
Description: The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene.

Anti-FHL3 antibody

STJ190217 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FHL3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-FHL3 / SLIM2 antibody

STJ70600 100 µg
EUR 359

FHL3 Blocking Peptide

33R-3837 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FHL3 antibody, catalog no. 70R-8913

FHL3 Blocking Peptide

DF8826-BP 1mg
EUR 195

FHL3 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

FHL3 cloning plasmid

CSB-CL618796HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgcctgggtcccggaagctggaatatggaggccagacatggcatgagcactgcttcctgtgcagtggctgtgaacagccactgggctcccgttcttttgtgcccgacaagggtgctcactactgcgtgccctgctatgagaacaagtttgctcctcgctgcgcccgctgcagcaa
  • Show more
Description: A cloning plasmid for the FHL3 gene.

FHL3 cloning plasmid

CSB-CL618796HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atgagcgagtcatttgactgtgcaaaatgcaacgagtccctgtatggacgcaagtacatccagacagacagcggcccctactgtgtgccctgctatgacaatacctttgccaacacctgtgctgagtgccagcagcttatcgggcatgactcgagggagctgttctatgaagaccg
  • Show more
Description: A cloning plasmid for the FHL3 gene.

pENTR223-FHL3 vector

PVT11935 2 ug
EUR 308

Anti-FHL3 (2C10)

YF-MA13026 100 ug
EUR 363
Description: Mouse monoclonal to FHL3

FHL3 protein (His tag)

80R-3544 50 ug
EUR 327
Description: Purified recombinant FHL3 protein (His tag)


EF009628 96 Tests
EUR 689

Mouse FHL3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FHL3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FHL3 Recombinant Protein (Human)

RP012172 100 ug Ask for price

FHL3 Recombinant Protein (Human)

RP012175 100 ug Ask for price

FHL3 Recombinant Protein (Rat)

RP201401 100 ug Ask for price

FHL3 Recombinant Protein (Mouse)

RP134603 100 ug Ask for price

Fhl3 ORF Vector (Rat) (pORF)

ORF067135 1.0 ug DNA
EUR 506

FHL3 ORF Vector (Human) (pORF)

ORF004058 1.0 ug DNA
EUR 95

FHL3 ORF Vector (Human) (pORF)

ORF004059 1.0 ug DNA
EUR 95

Fhl3 ORF Vector (Mouse) (pORF)

ORF044869 1.0 ug DNA
EUR 506

Fhl3 sgRNA CRISPR Lentivector set (Rat)

K6174801 3 x 1.0 ug
EUR 339

FHL3 sgRNA CRISPR Lentivector set (Human)

K0782001 3 x 1.0 ug
EUR 339

Fhl3 sgRNA CRISPR Lentivector set (Mouse)

K4460501 3 x 1.0 ug
EUR 339

Four And A Half LIM Domains 3 (FHL3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

abx215361-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

abx233112-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

abx430147-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6174802 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6174803 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6174804 1.0 ug DNA
EUR 154

FHL3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0782002 1.0 ug DNA
EUR 154

FHL3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0782003 1.0 ug DNA
EUR 154

FHL3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0782004 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4460502 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4460503 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4460504 1.0 ug DNA
EUR 154

FHL3 Protein Vector (Mouse) (pPB-C-His)

PV179474 500 ng
EUR 603

FHL3 Protein Vector (Mouse) (pPB-N-His)

PV179475 500 ng
EUR 603

FHL3 Protein Vector (Mouse) (pPM-C-HA)

PV179476 500 ng
EUR 603

FHL3 Protein Vector (Mouse) (pPM-C-His)

PV179477 500 ng
EUR 603

FHL3 Protein Vector (Rat) (pPB-C-His)

PV268538 500 ng
EUR 603

FHL3 Protein Vector (Rat) (pPB-N-His)

PV268539 500 ng
EUR 603

FHL3 Protein Vector (Rat) (pPM-C-HA)

PV268540 500 ng
EUR 603

FHL3 Protein Vector (Rat) (pPM-C-His)

PV268541 500 ng
EUR 603

FHL3 Protein Vector (Human) (pPB-C-His)

PV016229 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPB-N-His)

PV016230 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPM-C-HA)

PV016231 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPM-C-His)

PV016232 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPB-C-His)

PV016233 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPB-N-His)

PV016234 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPM-C-HA)

PV016235 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPM-C-His)

PV016236 500 ng
EUR 329

Fhl3 3'UTR GFP Stable Cell Line

TU156570 1.0 ml Ask for price

Fhl3 3'UTR Luciferase Stable Cell Line

TU106570 1.0 ml Ask for price

Fhl3 3'UTR Luciferase Stable Cell Line

TU204634 1.0 ml Ask for price

Fhl3 3'UTR GFP Stable Cell Line

TU254634 1.0 ml Ask for price

FHL3 3'UTR GFP Stable Cell Line

TU057969 1.0 ml
EUR 1394

FHL3 3'UTR Luciferase Stable Cell Line

TU007969 1.0 ml
EUR 1394

FHL3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV710163 1.0 ug DNA
EUR 316

FHL3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV710167 1.0 ug DNA
EUR 316

FHL3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV710168 1.0 ug DNA
EUR 316

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME


Scroll to Top