FHL3 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

FHL3 Rabbit pAb

A8679-100ul 100 ul
EUR 308

FHL3 Rabbit pAb

A8679-200ul 200 ul
EUR 459

FHL3 Rabbit pAb

A8679-20ul 20 ul
EUR 183

FHL3 Rabbit pAb

A8679-50ul 50 ul
EUR 223

FHL3 Antibody

ABD8826 100 ug
EUR 438

FHL3 antibody

70R-49746 100 ul
EUR 244
Description: Purified Polyclonal FHL3 antibody

FHL3 antibody

70R-8913 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FHL3 antibody

FHL3 Antibody

36483-100ul 100ul
EUR 252

FHL3 antibody

70R-17303 50 ul
EUR 435
Description: Rabbit polyclonal FHL3 antibody

FHL3 Antibody

DF8826 200ul
EUR 304
Description: FHL3 Antibody detects endogenous levels of total FHL3.

FHL3 Antibody

1-CSB-PA977533
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

FHL3 Antibody

1-CSB-PA985521
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FHL3 Antibody

1-CSB-PA618796ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FHL3 Antibody

1-CSB-PA618796ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

FHL3 Antibody

1-CSB-PA008665GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal Goat Anti-FHL3 / SLIM2 Antibody

APG00126G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FHL3 / SLIM2 . This antibody is tested and proven to work in the following applications:

FHL3 Conjugated Antibody

C36483 100ul
EUR 397

anti- FHL3 antibody

FNab03112 100µg
EUR 505.25
  • Immunogen: four and a half LIM domains 3
  • Uniprot ID: Q13643
  • Gene ID: 2275
  • Research Area: Developmental biology
Description: Antibody raised against FHL3

Anti-FHL3 Antibody

PB10064 100ug/vial
EUR 294

Anti-FHL3 antibody

PAab03112 100 ug
EUR 355

Anti-FHL3 antibody

STJ111377 100 µl
EUR 277
Description: The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene.

Anti-FHL3 antibody

STJ190217 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FHL3

FHL3 siRNA

20-abx916878
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FHL3 siRNA

20-abx916879
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-FHL3 / SLIM2 antibody

STJ70600 100 µg
EUR 359

FHL3 cloning plasmid

CSB-CL618796HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgcctgggtcccggaagctggaatatggaggccagacatggcatgagcactgcttcctgtgcagtggctgtgaacagccactgggctcccgttcttttgtgcccgacaagggtgctcactactgcgtgccctgctatgagaacaagtttgctcctcgctgcgcccgctgcagcaa
  • Show more
Description: A cloning plasmid for the FHL3 gene.

FHL3 cloning plasmid

CSB-CL618796HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atgagcgagtcatttgactgtgcaaaatgcaacgagtccctgtatggacgcaagtacatccagacagacagcggcccctactgtgtgccctgctatgacaatacctttgccaacacctgtgctgagtgccagcagcttatcgggcatgactcgagggagctgttctatgaagaccg
  • Show more
Description: A cloning plasmid for the FHL3 gene.

FHL3 Blocking Peptide

20-abx062621
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

FHL3 Blocking Peptide

33R-3837 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FHL3 antibody, catalog no. 70R-8913

FHL3 Blocking Peptide

DF8826-BP 1mg
EUR 195

pENTR223-FHL3 vector

PVT11935 2 ug
EUR 308

Anti-FHL3 (2C10)

YF-MA13026 100 ug
EUR 363
Description: Mouse monoclonal to FHL3

FHL3 ELISA KIT|Human

EF009628 96 Tests
EUR 689

FHL3 protein (His tag)

80R-3544 50 ug
EUR 327
Description: Purified recombinant FHL3 protein (His tag)

Mouse FHL3 shRNA Plasmid

20-abx970340
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FHL3 shRNA Plasmid

20-abx951592
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FHL3 Recombinant Protein (Human)

RP012172 100 ug Ask for price

FHL3 Recombinant Protein (Human)

RP012175 100 ug Ask for price

FHL3 Recombinant Protein (Rat)

RP201401 100 ug Ask for price

FHL3 Recombinant Protein (Mouse)

RP134603 100 ug Ask for price

FHL3 ORF Vector (Human) (pORF)

ORF004058 1.0 ug DNA
EUR 95

FHL3 ORF Vector (Human) (pORF)

ORF004059 1.0 ug DNA
EUR 95

Fhl3 ORF Vector (Rat) (pORF)

ORF067135 1.0 ug DNA
EUR 506

Fhl3 ORF Vector (Mouse) (pORF)

ORF044869 1.0 ug DNA
EUR 506

FHL3 sgRNA CRISPR Lentivector set (Human)

K0782001 3 x 1.0 ug
EUR 339

Fhl3 sgRNA CRISPR Lentivector set (Mouse)

K4460501 3 x 1.0 ug
EUR 339

Fhl3 sgRNA CRISPR Lentivector set (Rat)

K6174801 3 x 1.0 ug
EUR 339

Four And A Half LIM Domains 3 (FHL3) Antibody

20-abx123606
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

20-abx112586
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

20-abx009262
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

20-abx321199
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

20-abx322016
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

abx215361-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

abx430147-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

20-abx210835
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

20-abx212508
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Four And A Half LIM Domains 3 (FHL3) Antibody

abx233112-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

FHL3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0782002 1.0 ug DNA
EUR 154

FHL3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0782003 1.0 ug DNA
EUR 154

FHL3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0782004 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4460502 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4460503 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4460504 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6174802 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6174803 1.0 ug DNA
EUR 154

Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6174804 1.0 ug DNA
EUR 154

FHL3 Protein Vector (Rat) (pPB-C-His)

PV268538 500 ng
EUR 603

FHL3 Protein Vector (Rat) (pPB-N-His)

PV268539 500 ng
EUR 603

FHL3 Protein Vector (Rat) (pPM-C-HA)

PV268540 500 ng
EUR 603

FHL3 Protein Vector (Rat) (pPM-C-His)

PV268541 500 ng
EUR 603

FHL3 Protein Vector (Mouse) (pPB-C-His)

PV179474 500 ng
EUR 603

FHL3 Protein Vector (Mouse) (pPB-N-His)

PV179475 500 ng
EUR 603

FHL3 Protein Vector (Mouse) (pPM-C-HA)

PV179476 500 ng
EUR 603

FHL3 Protein Vector (Mouse) (pPM-C-His)

PV179477 500 ng
EUR 603

FHL3 Protein Vector (Human) (pPB-C-His)

PV016229 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPB-N-His)

PV016230 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPM-C-HA)

PV016231 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPM-C-His)

PV016232 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPB-C-His)

PV016233 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPB-N-His)

PV016234 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPM-C-HA)

PV016235 500 ng
EUR 329

FHL3 Protein Vector (Human) (pPM-C-His)

PV016236 500 ng
EUR 329

Fhl3 3'UTR Luciferase Stable Cell Line

TU204634 1.0 ml Ask for price

Fhl3 3'UTR GFP Stable Cell Line

TU156570 1.0 ml Ask for price

FHL3 3'UTR Luciferase Stable Cell Line

TU007969 1.0 ml
EUR 1394

Fhl3 3'UTR Luciferase Stable Cell Line

TU106570 1.0 ml Ask for price

FHL3 3'UTR GFP Stable Cell Line

TU057969 1.0 ml
EUR 1394

Fhl3 3'UTR GFP Stable Cell Line

TU254634 1.0 ml Ask for price

FHL3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV710163 1.0 ug DNA
EUR 316

FHL3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV710167 1.0 ug DNA
EUR 316

FHL3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV710168 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

 

Scroll to Top