HDGF Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

HDGF Polyclonal Antibody

ABP58763-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

HDGF Polyclonal Antibody

ABP58763-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

HDGF Polyclonal Antibody

ABP58763-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

HDGF Polyclonal Antibody

ES8731-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HDGF from Human. This antibody is tested and validated for IHC, WB, ELISA

HDGF Polyclonal Antibody

ES8731-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HDGF from Human. This antibody is tested and validated for IHC, WB, ELISA

HDGF Rabbit pAb

A13654-100ul 100 ul
EUR 308

HDGF Rabbit pAb

A13654-200ul 200 ul
EUR 459

HDGF Rabbit pAb

A13654-20ul 20 ul
EUR 183

HDGF Rabbit pAb

A13654-50ul 50 ul
EUR 223

HDGF Rabbit pAb

A5347-100ul 100 ul
EUR 308

HDGF Rabbit pAb

A5347-200ul 200 ul
EUR 459

HDGF Rabbit pAb

A5347-20ul 20 ul
EUR 183

HDGF Rabbit pAb

A5347-50ul 50 ul
EUR 223

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Hu-48T 48T
EUR 425
  • Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Hu-96T 96T
EUR 548
  • Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Mu-48T 48T
EUR 435
  • Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Mu-96T 96T
EUR 561
  • Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Hu-48Tests 48 Tests
EUR 436

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Hu-96Tests 96 Tests
EUR 601

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Mu-48Tests 48 Tests
EUR 447

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Mu-96Tests 96 Tests
EUR 618

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Hu-48Tests 48 Tests
EUR 418

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Hu-96Tests 96 Tests
EUR 575

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Mu-48Tests 48 Tests
EUR 429

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Mu-96Tests 96 Tests
EUR 591

Rabbit HDGF ELISA Kit

ERTH0054 96Tests
EUR 521

Polyclonal HDGF Antibody (C-term)

APR05752G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal HDGF Antibody (C-term)

APR06952G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF (C-term). This antibody is tested and proven to work in the following applications:

HDGF Polyclonal Antibody, HRP Conjugated

A53045 100 µg
EUR 570.55
Description: reagents widely cited

HDGF Polyclonal Antibody, FITC Conjugated

A53046 100 µg
EUR 570.55
Description: Ask the seller for details

HDGF Polyclonal Antibody, Biotin Conjugated

A53047 100 µg
EUR 570.55
Description: The best epigenetics products

HDGF antibody

70R-17711 50 ul
EUR 435
Description: Rabbit polyclonal HDGF antibody

HDGF Antibody

32788-100ul 100ul
EUR 252

HDGF antibody

10R-1523 100 ug
EUR 512
Description: Mouse monoclonal HDGF antibody

HDGF Antibody

DF7289 200ul
EUR 304
Description: HDGF Antibody detects endogenous levels of total HDGF.

HDGF Antibody

1-CSB-PA01004A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA

HDGF Antibody

1-CSB-PA010249GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HDGF Antibody

ABD7289 100 ug
EUR 438

Anti-HDGF Antibody

A01057 100ug/vial
EUR 334

HDGF Conjugated Antibody

C32788 100ul
EUR 397

anti- HDGF antibody

FNab03808 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: hepatoma-derived growth factor (high-mobility group protein 1-like)
  • Uniprot ID: P51858
  • Gene ID: 3068
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF

anti- HDGF antibody

FNab03809 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:5000
  • IF: 1:10-1:100
  • IHC: 1:50-1:500
  • Immunogen: hepatoma-derived growth factor(high-mobility group protein 1-like)
  • Uniprot ID: P51858
  • Gene ID: 81932
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF

Anti-HDGF antibody

PAab03808 100 ug
EUR 412

Anti-HDGF antibody

STJ27300 100 µl
EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Anti-HDGF antibody

STJ115610 100 µl
EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Anti-HDGF antibody

STJ98794 200 µl
EUR 197
Description: Rabbit polyclonal to HDGF.

Hdgf/ Rat Hdgf ELISA Kit

ELI-38905r 96 Tests
EUR 886

HDGF protein

30R-1402 100 ug
EUR 397
Description: Purified recombinant Human HDGF protein

HDGF siRNA

20-abx902439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDGF siRNA

20-abx919203
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDGF siRNA

20-abx919204
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-HDGF

PVT14602 2 ug
EUR 495

anti-HDGF

YF-PA12275 50 ug
EUR 363
Description: Mouse polyclonal to HDGF

anti-HDGF

YF-PA23871 50 ul
EUR 334
Description: Mouse polyclonal to HDGF

HDGF Antibody, HRP conjugated

1-CSB-PA01004B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HDGF Antibody, FITC conjugated

1-CSB-PA01004C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HDGF Antibody, Biotin conjugated

1-CSB-PA01004D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human)

4-PAA624Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF)

HDGF Blocking Peptide

DF7289-BP 1mg
EUR 195

HDGF cloning plasmid

CSB-CL010249HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: atgtcgcgatccaaccggcagaaggagtacaaatgcggggacctggtgttcgccaagatgaagggctacccacactggccggcccggattgacgagatgcctgaggctgccgtgaaatcaacagccaacaaataccaagtcttttttttcgggacccacgagacggcattcctggg
  • Show more
Description: A cloning plasmid for the HDGF gene.

pOTB7-HDGF Plasmid

PVTB00247S 2 ug
EUR 356

Anti-HDGF (2D6)

YF-MA13429 100 ug
EUR 363
Description: Mouse monoclonal to HDGF

HDGF Like 3 (HDGFL3) Antibody

20-abx327580
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), APC

4-PAA624Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), Biotinylated

4-PAA624Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Biotin.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), Cy3

4-PAA624Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Cy3.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), FITC

4-PAA624Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with FITC.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), HRP

4-PAA624Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with HRP.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), PE

4-PAA624Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with PE.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse)

4-PAA624Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF)

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), APC-Cy7

4-PAA624Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Tyr10~Leu240)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC-Cy7.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), APC

4-PAA624Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAA624Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Biotin.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), Cy3

4-PAA624Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Cy3.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), FITC

4-PAA624Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with FITC.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), HRP

4-PAA624Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with HRP.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), PE

4-PAA624Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with PE.

Hepatoma Derived Growth Factor (HDGF) Antibody

20-abx004089
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody

20-abx176825
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatoma Derived Growth Factor (HDGF) Antibody

20-abx176826
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatoma Derived Growth Factor (HDGF) Antibody

20-abx103152
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody

20-abx112980
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody

20-abx128720
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody

20-abx109863
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody

20-abx172791
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hepatoma Derived Growth Factor (HDGF) Antibody

abx032817-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody

abx032817-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody

abx233808-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody

abx233809-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody

20-abx225213
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human HDGF ELISA Kit

EHH0054 96Tests
EUR 521

Goat HDGF ELISA Kit

EGTH0054 96Tests
EUR 521

Bovine HDGF ELISA Kit

EBH0054 96Tests
EUR 521

Anserini HDGF ELISA Kit

EAH0054 96Tests
EUR 521

HDGF ELISA KIT|Human

EF010085 96 Tests
EUR 689

Rat HDGF shRNA Plasmid

20-abx987193
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HDGF shRNA Plasmid

20-abx952089
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HDGF shRNA Plasmid

20-abx970772
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat HDGF ELISA Kit

ERH0054 96Tests
EUR 521

Mouse HDGF ELISA Kit

EMH0054 96Tests
EUR 521

Porcine HDGF ELISA Kit

EPH0054 96Tests
EUR 521

pECMV-3-FLAG-HDGF

PVT14606 2 ug
EUR 495

HDGF Recombinant Protein (Human)

RP014515 100 ug Ask for price

HDGF Recombinant Protein (Rat)

RP204359 100 ug Ask for price

HDGF Recombinant Protein (Mouse)

RP141161 100 ug Ask for price

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAA624Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HDGF (Asp14~Gly187)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC-Cy7.

Human Hepatoma-Derived Growth Factor (HDGF) Antibody

32013-05111 150 ug
EUR 261

Hepatoma Derived Growth Factor (HDGF) Antibody (Biotin)

20-abx105506
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody (FITC)

20-abx106923
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody (HRP)

20-abx108345
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea Pig HDGF ELISA Kit

EGH0054 96Tests
EUR 521

Hdgf ORF Vector (Rat) (pORF)

ORF068121 1.0 ug DNA
EUR 506

HDGF ORF Vector (Human) (pORF)

ORF004839 1.0 ug DNA
EUR 95

Hdgf ORF Vector (Mouse) (pORF)

ORF047055 1.0 ug DNA
EUR 506

pFastBac TM1 Signal-HDGF Plasmid

PVTB00247-2a 2 ug
EUR 356

HDGF ELISA Kit (Human) (OKAN06027)

OKAN06027 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

Hdgf ELISA Kit (Mouse) (OKCD01531)

OKCD01531 96 Wells
EUR 779
Description: Description of target: Heparin-binding protein, with mitogenic activity for fibroblasts. Acts as a transcriptional repressor.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.4 pg/mL

HDGF ELISA Kit (Human) (OKCD00249)

OKCD00249 96 Wells
EUR 792
Description: Description of target: Heparin-binding protein, with mitogenic activity for fibroblasts. Acts as a transcriptional repressor.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.11"Hepatoma-derived growth factor binds DNA through the N-terminal PWWP domain."_x005F_x005F_x000D_Yang J., Everett A.D._x005F_x005F_x000D_BMC Mol. Biol. 8:101-101(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, DNA-BINDING. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

Mouse Hepatoma-derived growth factor (Hdgf)

1-CSB-YP010249MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Hepatoma-derived growth factor(Hdgf) expressed in Yeast

Hdgf sgRNA CRISPR Lentivector set (Mouse)

K4641401 3 x 1.0 ug
EUR 339

Hdgf sgRNA CRISPR Lentivector set (Rat)

K6948001 3 x 1.0 ug
EUR 339

HDGF sgRNA CRISPR Lentivector set (Human)

K0941201 3 x 1.0 ug
EUR 339

Recombinant Hepatoma Derived Growth Factor (HDGF)

4-RPA624Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51858
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: 4.9
Description: Recombinant Human Hepatoma Derived Growth Factor expressed in: E.coli

Recombinant Hepatoma Derived Growth Factor (HDGF)

4-RPA624Mu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51859
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.8kDa
  • Isoelectric Point: 5.4
Description: Recombinant Mouse Hepatoma Derived Growth Factor expressed in: E.coli

Human Hepatoma-Derived Growth Factor (HDGF) Antibody (Biotin Conjugate)

32013-05121 150 ug
EUR 369

Human Hepatoma Derived Growth Factor (HDGF) Protein

20-abx168070
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Hepatoma Derived Growth Factor (HDGF) Protein

20-abx067076
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Hepatoma Derived Growth Factor (HDGF) Protein

20-abx261882
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Rat Hepatoma Derived Growth Factor (HDGF) Protein

20-abx653734
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4641402 1.0 ug DNA
EUR 154

Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4641403 1.0 ug DNA
EUR 154

Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4641404 1.0 ug DNA
EUR 154

Hdgf sgRNA CRISPR Lentivector (Rat) (Target 1)

K6948002 1.0 ug DNA
EUR 154

Hdgf sgRNA CRISPR Lentivector (Rat) (Target 2)

K6948003 1.0 ug DNA
EUR 154

Hdgf sgRNA CRISPR Lentivector (Rat) (Target 3)

K6948004 1.0 ug DNA
EUR 154

HDGF sgRNA CRISPR Lentivector (Human) (Target 1)

K0941202 1.0 ug DNA
EUR 154

HDGF sgRNA CRISPR Lentivector (Human) (Target 2)

K0941203 1.0 ug DNA
EUR 154

HDGF sgRNA CRISPR Lentivector (Human) (Target 3)

K0941204 1.0 ug DNA
EUR 154

HDGF Protein Vector (Rat) (pPB-C-His)

PV272482 500 ng
EUR 603

HDGF Protein Vector (Rat) (pPB-N-His)

PV272483 500 ng
EUR 603

HDGF Protein Vector (Rat) (pPM-C-HA)

PV272484 500 ng
EUR 603

HDGF Protein Vector (Rat) (pPM-C-His)

PV272485 500 ng
EUR 603

HDGF Protein Vector (Mouse) (pPB-C-His)

PV188218 500 ng
EUR 603

HDGF Protein Vector (Mouse) (pPB-N-His)

PV188219 500 ng
EUR 603

HDGF Protein Vector (Mouse) (pPM-C-HA)

PV188220 500 ng
EUR 603

HDGF Protein Vector (Mouse) (pPM-C-His)

PV188221 500 ng
EUR 603

HDGF Protein Vector (Human) (pPB-C-His)

PV019353 500 ng
EUR 329

HDGF Protein Vector (Human) (pPB-N-His)

PV019354 500 ng
EUR 329

HDGF Protein Vector (Human) (pPM-C-HA)

PV019355 500 ng
EUR 329

HDGF Protein Vector (Human) (pPM-C-His)

PV019356 500 ng
EUR 329

Recombinant Human HDGF Protein, Untagged, E.coli-1mg

QP12205-1mg 1mg
EUR 3655

Recombinant Human HDGF Protein, Untagged, E.coli-20ug

QP12205-20ug 20ug
EUR 201

Recombinant Human HDGF Protein, Untagged, E.coli-5ug

QP12205-5ug 5ug
EUR 155

Hdgf 3'UTR Luciferase Stable Cell Line

TU109417 1.0 ml Ask for price

Hdgf 3'UTR Luciferase Stable Cell Line

TU205696 1.0 ml Ask for price

Hdgf 3'UTR GFP Stable Cell Line

TU159417 1.0 ml Ask for price

Hdgf 3'UTR GFP Stable Cell Line

TU255696 1.0 ml Ask for price

HDGF 3'UTR GFP Stable Cell Line

TU059672 1.0 ml
EUR 1394

HDGF 3'UTR Luciferase Stable Cell Line

TU009672 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

 

Scroll to Top