HIPK1 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

HIPK1 Polyclonal Antibody

ABP58782-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950

HIPK1 Polyclonal Antibody

ABP58782-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950

HIPK1 Polyclonal Antibody

ABP58782-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950

HIPK1 Polyclonal Antibody

ES8953-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 Polyclonal Antibody

ES8953-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 Polyclonal Antibody

ES9076-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 Polyclonal Antibody

ES9076-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 antibody

70R-2078 50 ug
EUR 467
Description: Rabbit polyclonal HIPK1 antibody raised against the middle region of HIPK1

HIPK1 Antibody

37619-100ul 100ul
EUR 252

HIPK1 Antibody

1-CSB-PA145013
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

HIPK1 Antibody

1-CSB-PA803159LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

HIPK1 Antibody

DF8847 200ul
EUR 304
Description: HIPK1 Antibody detects endogenous levels of total HIPK1.

HIPK1 Antibody

1-CSB-PA035565
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100

HIPK1 Antibody

ABD8847 100 ug
EUR 438

Polyclonal HIPK1 Antibody (C-term)

APR16693G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HIPK1 (C-term). This antibody is tested and proven to work in the following applications:

HIPK1 Polyclonal Antibody, HRP Conjugated

A69028 100 ?g
EUR 628.55
Description: fast delivery possible

HIPK1 Polyclonal Antibody, FITC Conjugated

A69029 100 ?g
EUR 628.55
Description: reagents widely cited

HIPK1 Polyclonal Antibody, Biotin Conjugated

A69030 100 ?g
EUR 628.55
Description: Ask the seller for details

HIPK1 Conjugated Antibody

C37619 100ul
EUR 397

Anti-HIPK1 Antibody

STJ501340 100 µg
EUR 476

Anti-HIPK1 antibody

STJ190111 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HIPK1

Anti-HIPK1 antibody

STJ190234 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HIPK1

Hipk1/ Rat Hipk1 ELISA Kit

ELI-38786r 96 Tests
EUR 886

HIPK1 siRNA

20-abx919387
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HIPK1 siRNA

20-abx919388
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-HIPK1

YF-PA26972 50 ul
EUR 334
Description: Mouse polyclonal to HIPK1

HIPK1 Antibody, HRP conjugated

1-CSB-PA803159LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HIPK1 Antibody, FITC conjugated

1-CSB-PA803159LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HIPK1 Antibody, Biotin conjugated

1-CSB-PA803159LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HIPK1/2/3 Antibody

DF10333 200ul
EUR 304
Description: HIPK1/2/3 Antibody detects endogenous levels of HIPK1/2/3.

Anti-HIPK1 Antibody (Biotin)

STJ501341 100 µg
EUR 586

Anti-HIPK1 Antibody (FITC)

STJ501342 100 µg
EUR 586

HIPK1 Blocking Peptide

33R-7200 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HIPK1 antibody, catalog no. 70R-2078

HIPK1 Blocking Peptide

DF8847-BP 1mg
EUR 195

HIPK1 cloning plasmid

CSB-CL803159HU-10ug 10ug
EUR 796
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2451
  • Sequence: atggttttgatgtttcagattcgttatatttcacaaacacaaggcttgccagctgaatatcttctcagtgccggaacaaaaacaaccaggtttttcaacagagatcctaatttggggtacccactgtggaggcttaagacacctgaagaacatgaactggagactggaataaaat
  • Show more
Description: A cloning plasmid for the HIPK1 gene.

Anti-HIPK1 (4C2)

YF-MA11764 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Anti-HIPK1 (1D6)

YF-MA11765 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Anti-HIPK1 (1F2)

YF-MA20025 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Anti-HIPK1 (4D5)

YF-MA20026 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Anti-HIPK1 (4E1)

YF-MA20027 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human)

4-PAC526Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1)

Human HIPK1 shRNA Plasmid

20-abx966354
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HIPK1 shRNA Plasmid

20-abx970805
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HIPK1/2/3 (Phospho-Tyr352/361/359) Polyclonal Conjugated Antibody

C12507 100ul
EUR 397

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), APC

4-PAC526Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with APC.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), Biotinylated

4-PAC526Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with Biotin.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), Cy3

4-PAC526Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with Cy3.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), FITC

4-PAC526Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with FITC.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), HRP

4-PAC526Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with HRP.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), PE

4-PAC526Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with PE.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), APC-Cy7

4-PAC526Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with APC-Cy7.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody

abx026832-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody

abx026832-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody

20-abx213865
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody

20-abx213933
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

HIPK1 / 2 / 3 (pY352 / 361 / 359) Antibody

abx215887-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody

20-abx131354
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody

abx145234-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Monoclonal HIPK1 Antibody (clone 1D6), Clone: 1D6

APR16694G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human HIPK1 (clone 1D6). The antibodies are raised in Mouse and are from clone 1D6. This antibody is applicable in IHC-P, E

Monoclonal HIPK1 Antibody (monoclonal) (M04), Clone: 1F2

APR16695G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HIPK1 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 1F2. This antibody is applicable in WB and IF

Monoclonal HIPK1 Antibody (monoclonal) (M07), Clone: 40

APR16696G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HIPK1 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 40. This antibody is applicable in WB and IF, E

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody

20-abx334178
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HIPK1/2/3 Blocking Peptide

DF10333-BP 1mg
EUR 195

Hipk1 ORF Vector (Rat) (pORF)

ORF068198 1.0 ug DNA
EUR 506

HIPK1 ORF Vector (Human) (pORF)

ORF004894 1.0 ug DNA
EUR 95

Hipk1 ORF Vector (Mouse) (pORF)

ORF047171 1.0 ug DNA
EUR 506

HIPK1/2/3 (Phospho-Tyr352/361/359) Antibody

12507-100ul 100ul
EUR 252

HIPK1/2/3 (Phospho-Tyr352/361/359) Antibody

12507-50ul 50ul
EUR 187

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody (HRP)

20-abx336060
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody (FITC)

20-abx336061
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody (Biotin)

20-abx336062
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospho-HIPK1/2/3 (Tyr352/361/359) Antibody

AF8155 200ul
EUR 376
Description: HIPK1/2/3 (Phospho-Tyr352/361/359) Antibody detects endogenous levels of HIPK1/2/3 only when phosphorylated at Tyr352/361/359.

HIPK1/2/3 (Phospho- Tyr352/361/359) Antibody

ABF8155 100 ug
EUR 438

Hipk1 sgRNA CRISPR Lentivector set (Mouse)

K4642801 3 x 1.0 ug
EUR 339

Hipk1 sgRNA CRISPR Lentivector set (Rat)

K6259901 3 x 1.0 ug
EUR 339

HIPK1 sgRNA CRISPR Lentivector set (Human)

K0952701 3 x 1.0 ug
EUR 339

Hipk1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4642802 1.0 ug DNA
EUR 154

Hipk1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4642803 1.0 ug DNA
EUR 154

Hipk1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4642804 1.0 ug DNA
EUR 154

Hipk1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6259902 1.0 ug DNA
EUR 154

Hipk1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6259903 1.0 ug DNA
EUR 154

Hipk1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6259904 1.0 ug DNA
EUR 154

HIPK1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0952702 1.0 ug DNA
EUR 154

HIPK1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0952703 1.0 ug DNA
EUR 154

HIPK1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0952704 1.0 ug DNA
EUR 154

HIPK1 Protein Vector (Rat) (pPB-C-His)

PV272790 500 ng
EUR 1191

HIPK1 Protein Vector (Rat) (pPB-N-His)

PV272791 500 ng
EUR 1191

HIPK1 Protein Vector (Rat) (pPM-C-HA)

PV272792 500 ng
EUR 1191

HIPK1 Protein Vector (Rat) (pPM-C-His)

PV272793 500 ng
EUR 1191

HIPK1 Protein Vector (Mouse) (pPB-C-His)

PV188682 500 ng
EUR 1065

HIPK1 Protein Vector (Mouse) (pPB-N-His)

PV188683 500 ng
EUR 1065

HIPK1 Protein Vector (Mouse) (pPM-C-HA)

PV188684 500 ng
EUR 1065

HIPK1 Protein Vector (Mouse) (pPM-C-His)

PV188685 500 ng
EUR 1065

HIPK1 Protein Vector (Human) (pPB-C-His)

PV019573 500 ng
EUR 329

HIPK1 Protein Vector (Human) (pPB-N-His)

PV019574 500 ng
EUR 329

HIPK1 Protein Vector (Human) (pPM-C-HA)

PV019575 500 ng
EUR 329

HIPK1 Protein Vector (Human) (pPM-C-His)

PV019576 500 ng
EUR 329

Recombinant Homeodomain Interacting Protein Kinase 1 (HIPK1)

4-RPC526Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86Z02
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Homeodomain Interacting Protein Kinase 1 expressed in: E.coli

Hipk1 3'UTR Luciferase Stable Cell Line

TU109514 1.0 ml Ask for price

Hipk1 3'UTR Luciferase Stable Cell Line

TU205779 1.0 ml Ask for price

Hipk1 3'UTR GFP Stable Cell Line

TU159514 1.0 ml Ask for price

Hipk1 3'UTR GFP Stable Cell Line

TU255779 1.0 ml Ask for price

HIPK1 3'UTR GFP Stable Cell Line

TU059792 1.0 ml
EUR 4617

HIPK1 3'UTR Luciferase Stable Cell Line

TU009792 1.0 ml
EUR 4617

Human Homeodomain Interacting Protein Kinase 1 (HIPK1) Protein

20-abx650018
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

HIPK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665323 1.0 ug DNA
EUR 1355

HIPK1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665327 1.0 ug DNA
EUR 1355

HIPK1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665328 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

 

Scroll to Top