HLA-DQA1 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

HLA-DQA1 Polyclonal Antibody

A52488 100 µg
EUR 570.55
Description: fast delivery possible

HLA-DQA1 Polyclonal Antibody

ABP58795-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HLA-DQA1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DQA1 from Human. This HLA-DQA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DQA1 protein at amino acid sequence of 21-70

HLA-DQA1 Polyclonal Antibody

ABP58795-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HLA-DQA1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DQA1 from Human. This HLA-DQA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DQA1 protein at amino acid sequence of 21-70

HLA-DQA1 Polyclonal Antibody

ABP58795-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HLA-DQA1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DQA1 from Human. This HLA-DQA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DQA1 protein at amino acid sequence of 21-70

HLA-DQA1 Polyclonal Antibody

ES8761-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HLA-DQA1 from Human. This antibody is tested and validated for IHC, WB, ELISA

HLA-DQA1 Polyclonal Antibody

ES8761-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HLA-DQA1 from Human. This antibody is tested and validated for IHC, WB, ELISA

HLA-DQA1 Rabbit mAb

A11252-100ul 100 ul
EUR 410

HLA-DQA1 Rabbit mAb

A11252-200ul 200 ul
EUR 571

HLA-DQA1 Rabbit mAb

A11252-20ul 20 ul
EUR 221

HLA-DQA1 Rabbit mAb

A11252-50ul 50 ul
EUR 287

HLA-DQA1 Rabbit pAb

A2168-100ul 100 ul
EUR 308

HLA-DQA1 Rabbit pAb

A2168-200ul 200 ul
EUR 459

HLA-DQA1 Rabbit pAb

A2168-20ul 20 ul
EUR 183

HLA-DQA1 Rabbit pAb

A2168-50ul 50 ul
EUR 223

HLA-DQA1 antibody

38391-100ul 100ul
EUR 252

HLA-DQA1 Antibody

49737-100ul 100ul
EUR 333

HLA-DQA1 Antibody

49737-50ul 50ul
EUR 239

HLA-DQA1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DQA1. Recognizes HLA-DQA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HLA-DQA1 Antibody

DF6891 200ul
EUR 304
Description: HLA-DQA1 Antibody detects endogenous levels of total HLA-DQA1.

HLA- DQA1 Antibody

ABD6891 100 ug
EUR 438

HLA-DQA2 & HLA-DQA1 Antibody

abx432803-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Polyclonal HLA-DQA2 & HLA-DQA1 Antibody (C-Term)

APG00711G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HLA-DQA2 & HLA-DQA1 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal HLA-DQA1 Antibody (N-term)

APR03658G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DQA1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal HLA-DQA1 Antibody (C-term)

APR04813G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DQA1 (C-term). This antibody is tested and proven to work in the following applications:

HLA-DQA1 Polyclonal Antibody, Biotin Conjugated

A52485 100 µg
EUR 570.55
Description: kits suitable for this type of research

HLA-DQA1 Polyclonal Antibody, FITC Conjugated

A52486 100 µg
EUR 570.55
Description: fast delivery possible

HLA-DQA1 Polyclonal Antibody, HRP Conjugated

A52487 100 µg
EUR 570.55
Description: reagents widely cited

HLA-DQA1 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HLA-DQA1 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HLA-DQA1 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HLA-DQA1 Antibody Pair

abx117603-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

HLA-DQA1 Conjugated Antibody

C49737 100ul
EUR 397

HLA-DQA1 Conjugated Antibody

C38391 100ul
EUR 397

Anti-HLA-DQA1 antibody

STJ24026 100 µl
EUR 277
Description: HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation.

Anti-HLA-DQA1 antibody

STJ98824 200 µl
EUR 197
Description: Rabbit polyclonal to HLA-DQA1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA12347 100 ug
EUR 403
Description: Rabbit polyclonal to HLA-DQA1

Anti-HLA-DQA2 & HLA-DQA1 antibody

STJ72385 100 µg
EUR 359

HLA-DQA1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DQA1. Recognizes HLA-DQA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HLA-DQA1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DQA1. Recognizes HLA-DQA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HLA-DQA1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DQA1. Recognizes HLA-DQA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Anti-HLA-DQA1 Monoclonal Antibody

M00232-1 100ug
EUR 397
Description: Rabbit Monoclonal HLA-DQA1 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

HLA-DQA1 Blocking Peptide

DF6891-BP 1mg
EUR 195

HLA-DQA1 cloning plasmid

CSB-CL365686HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atgatcctaaacaaagctctgatgctgggggcccttgccctgaccaccgtgatgagcccctgtggaggtgaagacattgtggctgaccacgtcgcctcttatggtgtaaacttgtaccagtcttacggtccctctggccagtacacccatgaatttgatggagatgagcagttcta
  • Show more
Description: A cloning plasmid for the HLA-DQA1 gene.

HLA-DQA1 cloning plasmid

CSB-CL365686HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Show more
Description: A cloning plasmid for the HLA-DQA1 gene.

HLA-DQA1 cloning plasmid

CSB-CL365686HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Show more
Description: A cloning plasmid for the HLA-DQA1 gene.


PVT13041 2 ug
EUR 391

Anti-HLA-DQA1 (1A3)

YF-MA13469 100 ug
EUR 363
Description: Mouse monoclonal to HLA-DQA1


ELI-31593h 96 Tests
EUR 824

Human HLA-DQA1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HLA-DQA1 Recombinant Protein (Human)

RP014881 100 ug Ask for price

HLA-DQA1 Recombinant Protein (Human)

RP039835 100 ug Ask for price

HLA-DQA1 Recombinant Protein (Human)

RP039838 100 ug Ask for price

MHC Class II DQA2 (HLA-DQA1) Antibody

abx415101-025mg 0.25 mg
EUR 592
  • Shipped within 1 week.

HLA-DQA1 ORF Vector (Human) (pORF)

ORF004961 1.0 ug DNA
EUR 95

HLA-DQA1 ORF Vector (Human) (pORF)

ORF013279 1.0 ug DNA
EUR 354

HLA-DQA1 ORF Vector (Human) (pORF)

ORF013280 1.0 ug DNA
EUR 354

MHC Class II DQA2 (HLA-DQA1) Antibody (FITC)

abx415102-01mg 0.1 mg
EUR 648
  • Shipped within 1 week.

MHC Class II DQA2 (HLA-DQA1) Antibody (RPE)

abx415103-100tests 100 tests
EUR 718
  • Shipped within 1 week.

HLA-DQA1 sgRNA CRISPR Lentivector set (Human)

K0964601 3 x 1.0 ug
EUR 339

HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody

abx025082-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody

abx025082-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain (HLA-DQA1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

HLA-DQA1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0964602 1.0 ug DNA
EUR 154

HLA-DQA1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0964603 1.0 ug DNA
EUR 154

HLA-DQA1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0964604 1.0 ug DNA
EUR 154

HLA-DQA1 Protein Vector (Human) (pPB-C-His)

PV019841 500 ng
EUR 329

HLA-DQA1 Protein Vector (Human) (pPB-N-His)

PV019842 500 ng
EUR 329

HLA-DQA1 Protein Vector (Human) (pPM-C-HA)

PV019843 500 ng
EUR 329

HLA-DQA1 Protein Vector (Human) (pPM-C-His)

PV019844 500 ng
EUR 329

HLA-DQA1 Protein Vector (Human) (pPB-C-His)

PV053113 500 ng
EUR 481

HLA-DQA1 Protein Vector (Human) (pPB-N-His)

PV053114 500 ng
EUR 481

HLA-DQA1 Protein Vector (Human) (pPM-C-HA)

PV053115 500 ng
EUR 481

HLA-DQA1 Protein Vector (Human) (pPM-C-His)

PV053116 500 ng
EUR 481

HLA-DQA1 Protein Vector (Human) (pPB-C-His)

PV053117 500 ng
EUR 481

HLA-DQA1 Protein Vector (Human) (pPB-N-His)

PV053118 500 ng
EUR 481

HLA-DQA1 Protein Vector (Human) (pPM-C-HA)

PV053119 500 ng
EUR 481

HLA-DQA1 Protein Vector (Human) (pPM-C-His)

PV053120 500 ng
EUR 481

Recombinant Human HLA-DQA1 Protein, His, E.coli-100ug

QP8817-ec-100ug 100ug
EUR 408

Recombinant Human HLA-DQA1 Protein, His, E.coli-10ug

QP8817-ec-10ug 10ug
EUR 200

Recombinant Human HLA-DQA1 Protein, His, E.coli-1mg

QP8817-ec-1mg 1mg
EUR 1632

Recombinant Human HLA-DQA1 Protein, His, E.coli-200ug

QP8817-ec-200ug 200ug
EUR 634

Recombinant Human HLA-DQA1 Protein, His, E.coli-500ug

QP8817-ec-500ug 500ug
EUR 1060

Recombinant Human HLA-DQA1 Protein, His, E.coli-50ug

QP8817-ec-50ug 50ug
EUR 263

HLA-DQA1 3'UTR GFP Stable Cell Line

TU059908 1.0 ml
EUR 1394

HLA-DQA1 3'UTR Luciferase Stable Cell Line

TU009908 1.0 ml
EUR 1394

Human HLA class II histocompatibility antigen, DQ alpha 1 chain (HLA-DQA1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 25.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human HLA class II histocompatibility antigen, DQ alpha 1 chain(HLA-DQA1),partial expressed in E.coli

HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV703491 1.0 ug DNA
EUR 450

HLA-DQA1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV703495 1.0 ug DNA
EUR 450

HLA-DQA1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV703496 1.0 ug DNA
EUR 450

HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV703503 1.0 ug DNA
EUR 450

HLA-DQA1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV703507 1.0 ug DNA
EUR 450

HLA-DQA1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV703508 1.0 ug DNA
EUR 450

HLA-DQA1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0964605 3 x 1.0 ug
EUR 376

Anti-HLA-DRA/Hla Dr Rabbit Monoclonal Antibody

M01195-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal HLA-DRA/Hla Dr Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

HLA-DMA Polyclonal Antibody

30759-100ul 100ul
EUR 252

HLA-DMA Polyclonal Antibody

30759-50ul 50ul
EUR 187

HLA-DMB Polyclonal Antibody

31536-100ul 100ul
EUR 252

HLA-DMB Polyclonal Antibody

31536-50ul 50ul
EUR 187

HLA-F Polyclonal Antibody

27409-100ul 100ul
EUR 252

HLA-F Polyclonal Antibody

27409-50ul 50ul
EUR 187

Polyclonal HLA-A Antibody

APR03304G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-A . This antibody is tested and proven to work in the following applications:

Polyclonal HLA-DPA1 Antibody

APR05440G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DPA1 . This antibody is tested and proven to work in the following applications:

HLA-DOAlpha Polyclonal Antibody

ABP51537-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DOAlpha from Human. This HLA-DOAlpha antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120

HLA-DOAlpha Polyclonal Antibody

ABP51537-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DOAlpha from Human. This HLA-DOAlpha antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120

HLA-DOAlpha Polyclonal Antibody

ABP51537-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DOAlpha from Human. This HLA-DOAlpha antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DO? at AA range: 40-120

HLA-DOBeta Polyclonal Antibody

ABP51538-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DOBeta from Human. This HLA-DOBeta antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90

HLA-DOBeta Polyclonal Antibody

ABP51538-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DOBeta from Human. This HLA-DOBeta antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90

HLA-DOBeta Polyclonal Antibody

ABP51538-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DOBeta from Human. This HLA-DOBeta antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HLA-DO? at AA range: 10-90

HLA-DPAlpha1 Polyclonal Antibody

ABP54742-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DP?1
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DPAlpha1 from Human. This HLA-DPAlpha1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DP?1

HLA-DPAlpha1 Polyclonal Antibody

ABP54742-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DP?1
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DPAlpha1 from Human. This HLA-DPAlpha1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DP?1

HLA-DPAlpha1 Polyclonal Antibody

ABP54742-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DP?1
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DPAlpha1 from Human. This HLA-DPAlpha1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DP?1

HLA-H Polyclonal Antibody

ABP54743-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-H from Human. This HLA-H antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120

HLA-H Polyclonal Antibody

ABP54743-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-H from Human. This HLA-H antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120

HLA-H Polyclonal Antibody

ABP54743-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-H from Human. This HLA-H antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-H at AA rangle: 40-120

HLA-DPB1 Polyclonal Antibody

A57886 100 µg
EUR 570.55
Description: kits suitable for this type of research

HLA-DMA Polyclonal Antibody

A59378 100 µg
EUR 570.55
Description: Ask the seller for details

HLA-DRB4 Polyclonal Antibody

A59382 100 µg
EUR 570.55
Description: kits suitable for this type of research

HLA-DRB1 Polyclonal Antibody

A50716 100 µg
EUR 570.55
Description: The best epigenetics products

HLA-E Polyclonal Antibody

A50748 100 µg
EUR 570.55
Description: kits suitable for this type of research

HLA-DRB1 Polyclonal Antibody

A52026 100 µg
EUR 570.55
Description: The best epigenetics products

HLA-B Polyclonal Antibody

A52237 100 µg
EUR 570.55
Description: fast delivery possible

HLA-DQA2 Polyclonal Antibody

A52480 100 µg
EUR 570.55
Description: reagents widely cited

HLA-C Polyclonal Antibody

A52484 100 µg
EUR 570.55
Description: The best epigenetics products

HLA-DRA Polyclonal Antibody

A53149 100 µg
EUR 570.55
Description: reagents widely cited

HLA-DPA1 Polyclonal Antibody

A53174 100 µg
EUR 570.55
Description: Ask the seller for details

HLA-G Polyclonal Antibody

A53328 100 µg
EUR 570.55
Description: Ask the seller for details

HLA-DMBeta Polyclonal Antibody

ABP58794-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DMBeta from Human. This HLA-DMBeta antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100

HLA-DMBeta Polyclonal Antibody

ABP58794-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DMBeta from Human. This HLA-DMBeta antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100

HLA-DMBeta Polyclonal Antibody

ABP58794-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DMBeta from Human. This HLA-DMBeta antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HLA-DM? protein at amino acid sequence of 40-100

HLA-DM? Polyclonal Antibody

ES8783-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HLA-DM? from Human. This antibody is tested and validated for IHC, WB, ELISA

HLA-DM? Polyclonal Antibody

ES8783-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HLA-DM? from Human. This antibody is tested and validated for IHC, WB, ELISA

HLA-DO? Polyclonal Antibody

ES2536-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HLA-DO? from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

HLA-DO? Polyclonal Antibody

ES2536-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HLA-DO? from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

HLA-DO? Polyclonal Antibody

ES2537-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HLA-DO? from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA-DO? Polyclonal Antibody

ES2537-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HLA-DO? from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA-H Polyclonal Antibody

ES5742-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HLA-H from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA-H Polyclonal Antibody

ES5742-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HLA-H from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA


EF010993 96 Tests
EUR 689

HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV703492 1.0 ug DNA
EUR 450

HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV703493 1.0 ug DNA
EUR 508

HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV703494 1.0 ug DNA
EUR 508

HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV703504 1.0 ug DNA
EUR 450

HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV703505 1.0 ug DNA
EUR 508

HLA-DQA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV703506 1.0 ug DNA
EUR 508

HLA-DQA1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0964606 1.0 ug DNA
EUR 167

HLA-DQA1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0964607 1.0 ug DNA
EUR 167

HLA-DQA1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0964608 1.0 ug DNA
EUR 167

HLA-DQB1/2 Polyclonal Antibody

41863-100ul 100ul
EUR 252

HLA-DQB1/2 Polyclonal Antibody

41863-50ul 50ul
EUR 187

Polyclonal HLA-DPB1 Antibody (Center)

APR03874G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DPB1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal HLA-DRB1 Antibody (Center)

APR04623G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRB1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal HLA-DRB1 Antibody (Center)

APR04702G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRB1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal HLA-F Antibody (Center)

APR05687G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-F (Center). This antibody is tested and proven to work in the following applications:

HLA-DMB Polyclonal Conjugated Antibody

C31536 100ul
EUR 397

HLA-F Polyclonal Conjugated Antibody

C27409 100ul
EUR 397

HLA-DMA Polyclonal Conjugated Antibody

C30759 100ul
EUR 397

Polyclonal HLA-G Antibody (Center)

APR06131G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-G (Center). This antibody is tested and proven to work in the following applications:

Polyclonal HLA-DRB5 Antibody (Center)

APR06202G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-DRB5 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal HLA-B Antibody (Center)

AMM05383G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-B (Center). This antibody is tested and proven to work in the following applications:

Polyclonal HLA-C Antibody (Center)

AMM05384G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HLA-C (Center). This antibody is tested and proven to work in the following applications:

HLA-DQB1/2 Polyclonal Antibody

ABP53223-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DQB1/2
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DQB1/2 from Human. This HLA-DQB1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DQB1/2

HLA-DQB1/2 Polyclonal Antibody

ABP53223-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DQB1/2
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DQB1/2 from Human. This HLA-DQB1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DQB1/2

HLA-DQB1/2 Polyclonal Antibody

ABP53223-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human HLA-DQB1/2
  • Applications tips:
Description: A polyclonal antibody for detection of HLA-DQB1/2 from Human. This HLA-DQB1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human HLA-DQB1/2

HLA Class I Polyclonal Antibody

ABP57490-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide of HLA Class I
  • Applications tips:
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of HLA Class I

HLA Class I Polyclonal Antibody

ABP57490-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of HLA Class I
  • Applications tips:
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of HLA Class I

HLA Class I Polyclonal Antibody

ABP57490-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of HLA Class I
  • Applications tips:
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of HLA Class I

HLA Class I Polyclonal Antibody

ABP57562-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 220-270
  • Applications tips:
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 220-270

HLA Class I Polyclonal Antibody

ABP57562-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 220-270
  • Applications tips:
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 220-270

HLA Class I Polyclonal Antibody

ABP57562-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 220-270
  • Applications tips:
Description: A polyclonal antibody for detection of HLA Class I from Human. This HLA Class I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 220-270

HLA Class I Polyclonal Antibody

ES8483-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HLA Class I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA Class I Polyclonal Antibody

ES8483-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HLA Class I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA Class I Polyclonal Antibody

ES8555-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HLA Class I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA Class I Polyclonal Antibody

ES8555-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HLA Class I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA-DQB1/2 Polyclonal Antibody

ES4222-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HLA-DQB1/2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

HLA-DQB1/2 Polyclonal Antibody

ES4222-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HLA-DQB1/2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

HLA-DP?1 Polyclonal Antibody

ES5741-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HLA-DP?1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA-DP?1 Polyclonal Antibody

ES5741-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HLA-DP?1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HLA-DRB4 Rabbit pAb

A10078-100ul 100 ul
EUR 308

HLA-DRB4 Rabbit pAb

A10078-200ul 200 ul
EUR 459

HLA-DRB4 Rabbit pAb

A10078-20ul 20 ul
EUR 183

HLA-DRB4 Rabbit pAb

A10078-50ul 50 ul
EUR 223

HLA-C Rabbit pAb

A1013-100ul 100 ul
EUR 308

HLA-C Rabbit pAb

A1013-200ul 200 ul
EUR 459

HLA-C Rabbit pAb

A1013-20ul 20 ul
EUR 183

HLA-C Rabbit pAb

A1013-50ul 50 ul
EUR 223

HLA-F Rabbit pAb

A10384-100ul 100 ul
EUR 308

HLA-F Rabbit pAb

A10384-200ul 200 ul
EUR 459

HLA-F Rabbit pAb

A10384-20ul 20 ul
EUR 183

HLA-F Rabbit pAb

A10384-50ul 50 ul
EUR 223

HLA-DRA Rabbit mAb

A10863-100ul 100 ul
EUR 410

HLA-DRA Rabbit mAb

A10863-200ul 200 ul
EUR 571

HLA-DRA Rabbit mAb

A10863-20ul 20 ul
EUR 221


Scroll to Top