ID1 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

ID1 Polyclonal Antibody
ES9039-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ID1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ID1 Rabbit pAb
A8432-100ul	Abclonal	100 ul	EUR 308

ID1 Rabbit pAb
A8432-200ul	Abclonal	200 ul	EUR 459

ID1 Rabbit pAb
A8432-20ul	Abclonal	20 ul	EUR 183

ID1 Rabbit pAb
A8432-50ul	Abclonal	50 ul	EUR 223

Polyclonal ID1 Antibody (Center)
APR03608G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal ID1 Antibody (Center)
APR05400G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID1 (Center). This antibody is tested and proven to work in the following applications:

Anti-Id1 Rabbit Monoclonal Antibody
M00945	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Id1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

ID1 antibody
70R-17876	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ID1 antibody

ID1 antibody
10R-1581	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal ID1 antibody

Id1 Antibody
49637-100ul	SAB	100ul	EUR 333

Id1 Antibody
49637-50ul	SAB	50ul	EUR 239

Id1 Antibody
45023-100ul	SAB	100ul	EUR 252

Id1 Antibody
45023-50ul	SAB	50ul	EUR 187

Id1 Antibody
DF2932	Affbiotech	200ul	EUR 304
Description: Id1 Antibody detects endogenous levels of total Id1.

ID1 antibody
70R-49891	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal ID1 antibody

ID1 Antibody
1-CSB-PA010966GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ID1. Recognizes ID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Id1 Antibody
ABD2932	Lifescience Market	100 ug	EUR 438

Id1 Conjugated Antibody
C49637	SAB	100ul	EUR 397

Id1 Conjugated Antibody
C45023	SAB	100ul	EUR 397

anti- ID1 antibody
FNab10217	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: DNA-binding protein inhibitor ID-1 Uniprot ID: P41134 Gene ID: 3397
Description: Antibody raised against ID1

anti- ID1 antibody
FNab04114	FN Test	100µg	EUR 548.75
Immunogen: inhibitor of DNA binding 1, dominant negative helix-loop-helix protein Uniprot ID: P41134 Gene ID: 3397 Research Area: Stem Cells, Cancer, Metabolism, Developmental biology
Description: Antibody raised against ID1

Anti-ID1 antibody
PAab04114	Lifescience Market	100 ug	EUR 386

Anti-ID1 antibody
STJ110730	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with members of the basic HLH family of transcription factors. The encoded protein has no DNA binding activity and therefore can inhibit the DNA binding and transcriptional activation ability of basic HLH proteins with which it interacts. This protein may play a role in cell growth, senescence, and differentiation. Two transcript variants encoding different isoforms have been found for this gene.

Anti-ID1 antibody
STJ190197	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ID1

Id1/ Rat Id1 ELISA Kit
ELI-08419r	Lifescience Market	96 Tests	EUR 886

ID1 siRNA
20-abx920129	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ID1 siRNA
20-abx920130	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-Id1
YF-PA12521	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Id1

Id1 recombinant monoclonal antibody
A5540	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human Id1 for WB, IHC, IF,ELISA

Id1 Blocking Peptide
DF2932-BP	Affbiotech	1mg	EUR 195

ID1 Blocking Peptide
20-abx062766	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

ID1 cloning plasmid
CSB-CL010966HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 468 Sequence: atgaaagtcgccagtggcagcaccgccaccgccgccgcgggccccagctgcgcgctgaaggccggcaagacagcgagcggtgcgggcgaggtggtgcgctgtctgtctgagcagagcgtggccatctcgcgctgcgccgggggcgccggggcgcgcctgcctgccctgctggacga Show more
Description: A cloning plasmid for the ID1 gene.

pcDNA3.1(+)-ID1 Plasmid
PVTB00963-2a	Lifescience Market	2 ug	EUR 356

pcDNA3.1(+)-ID1 Plasmid
PVTB00963-2b	Lifescience Market	2 ug	EUR 356

pCMV-SPORT6-ID1
PVT13646	Lifescience Market	2 ug	EUR 391

Anti-Id1 (1F7)
YF-MA10465	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Id1

Anti-ID1 (2E10)
YF-MA13626	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (4G11)
YF-MA13627	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (5D9)
YF-MA13628	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (4G7)
YF-MA13629	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (1B10)
YF-MA13630	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (3A9)
YF-MA13631	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (2C7)
YF-MA13632	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (1D9)
YF-MA13633	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (3F8)
YF-MA13634	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (3F3)
YF-MA13635	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (4F6)
YF-MA13636	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ID1

ID1 protein (His tag)
80R-2751	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant ID1 protein (His tag)

ID1 ELISA KIT|Human
EF010277	Lifescience Market	96 Tests	EUR 689

Rat ID1 shRNA Plasmid
20-abx984876	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ID1 shRNA Plasmid
20-abx952307	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ID1 Recombinant Protein (Human)
RP015526	ABM	100 ug	Ask for price

ID1 Recombinant Protein (Rat)
RP205430	ABM	100 ug	Ask for price

ID1 Recombinant Protein (Mouse)
RP142874	ABM	100 ug	Ask for price

Anti-ID1 (4D7-1A2)
YF-MA13625	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to ID1

Monoclonal ID1 Antibody (monoclonal) (M02), Clone: 1F7
AMM03647G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human ID1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1F7. This antibody is applicable in WB and IF, E

Monoclonal ID1 Antibody (monoclonal) (M04), Clone: 4G11
AMM03648G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human ID1 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4G11. This antibody is applicable in WB and IF, E

Id1 ORF Vector (Rat) (pORF)
ORF068478	ABM	1.0 ug DNA	EUR 506

ID1 ORF Vector (Human) (pORF)
ORF005176	ABM	1.0 ug DNA	EUR 95

Id1 ORF Vector (Mouse) (pORF)
ORF047626	ABM	1.0 ug DNA	EUR 506

ID1 ELISA Kit (Human) (OKCA00658)
OKCA00658	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Inhibits skeletal muscle and cardiac myocyte differentiation. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 pg/mL

ID1 ELISA Kit (Mouse) (OKCA01656)
OKCA01656	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Inhibits skeletal muscle and cardiac myocyte differentiation. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.86 pg/mL

ID1 ELISA Kit (Rat) (OKCA01869)
OKCA01869	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Inhibits skeletal muscle and cardiac myocyte differentiation. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

ID1 ELISA Kit (Human) (OKEH08357)
OKEH08357	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with members of the basic HLH family of transcription factors. The encoded protein has no DNA binding activity and therefore can inhibit the DNA binding and transcriptional activation ability of basic HLH proteins with which it interacts. This protein may play a role in cell growth, senescence, and differentiation. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.159ng/mL

Id1 ELISA Kit (Mouse) (OKEH08358)
OKEH08358	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

ID1 ELISA Kit (Rat) (OKEH08359)
OKEH08359	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: a negative regulator of gene transcription [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082ng/mL

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody
20-abx009130	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody
abx026408-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody
abx026408-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody
20-abx005928	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (Id1) Antibody
20-abx216130	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody
20-abx113131	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody
abx234114-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Id1 sgRNA CRISPR Lentivector set (Rat)
K6801201	ABM	3 x 1.0 ug	EUR 339

Id1 sgRNA CRISPR Lentivector set (Mouse)
K4367701	ABM	3 x 1.0 ug	EUR 339

ID1 sgRNA CRISPR Lentivector set (Human)
K1012301	ABM	3 x 1.0 ug	EUR 339

Id1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6801202	ABM	1.0 ug DNA	EUR 154

Id1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6801203	ABM	1.0 ug DNA	EUR 154

Id1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6801204	ABM	1.0 ug DNA	EUR 154

Id1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4367702	ABM	1.0 ug DNA	EUR 154

Id1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4367703	ABM	1.0 ug DNA	EUR 154

Id1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4367704	ABM	1.0 ug DNA	EUR 154

ID1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1012302	ABM	1.0 ug DNA	EUR 154

ID1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1012303	ABM	1.0 ug DNA	EUR 154

ID1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1012304	ABM	1.0 ug DNA	EUR 154

ID1 Protein Vector (Human) (pPB-C-His)
PV020701	ABM	500 ng	EUR 329

ID1 Protein Vector (Human) (pPB-N-His)
PV020702	ABM	500 ng	EUR 329

ID1 Protein Vector (Human) (pPM-C-HA)
PV020703	ABM	500 ng	EUR 329

ID1 Protein Vector (Human) (pPM-C-His)
PV020704	ABM	500 ng	EUR 329

ID1 Protein Vector (Rat) (pPB-C-His)
PV273910	ABM	500 ng	EUR 603

ID1 Protein Vector (Rat) (pPB-N-His)
PV273911	ABM	500 ng	EUR 603

ID1 Protein Vector (Rat) (pPM-C-HA)
PV273912	ABM	500 ng	EUR 603

ID1 Protein Vector (Rat) (pPM-C-His)
PV273913	ABM	500 ng	EUR 603

ID1 Protein Vector (Mouse) (pPB-C-His)
PV190502	ABM	500 ng	EUR 603

ID1 Protein Vector (Mouse) (pPB-N-His)
PV190503	ABM	500 ng	EUR 603

ID1 Protein Vector (Mouse) (pPM-C-HA)
PV190504	ABM	500 ng	EUR 603

ID1 Protein Vector (Mouse) (pPM-C-His)
PV190505	ABM	500 ng	EUR 603

Id1 3'UTR Luciferase Stable Cell Line
TU109874	ABM	1.0 ml	Ask for price

Id1 3'UTR Luciferase Stable Cell Line
TU206077	ABM	1.0 ml	Ask for price

Id1 3'UTR GFP Stable Cell Line
TU159874	ABM	1.0 ml	Ask for price

Id1 3'UTR GFP Stable Cell Line
TU256077	ABM	1.0 ml	Ask for price

ID1 3'UTR GFP Stable Cell Line
TU060400	ABM	1.0 ml	EUR 1364

ID1 3'UTR Luciferase Stable Cell Line
TU010400	ABM	1.0 ml	EUR 1364

Human DNA-binding protein inhibitor ID-1 (ID1)
1-CSB-EP010966HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 32.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human DNA-binding protein inhibitor ID-1(ID1) expressed in E.coli

Zebrafish Id1 Rbt pAb, Protein A purified, 25UG
A014-25UG	Arbor Assays	25UG	EUR 425