ID1 Rabbit Polyclonal Antibody

To Order:

ID1 Polyclonal Antibody

ABP58862-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ID1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of ID1 from Human, Mouse, Rat. This ID1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID1 protein at amino acid sequence of 30-110

ID1 Rabbit pAb

A8432-100ul 100 ul
EUR 308

ID1 Rabbit pAb

A8432-200ul 200 ul
EUR 459

ID1 Rabbit pAb

A8432-20ul 20 ul
EUR 183

ID1 Rabbit pAb

A8432-50ul 50 ul
EUR 223

Polyclonal ID1 Antibody (Center)

APR03608G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal ID1 Antibody (Center)

APR05400G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID1 (Center). This antibody is tested and proven to work in the following applications:

Anti-Id1 Rabbit Monoclonal Antibody

M00945 100ug/vial
EUR 397
Description: Rabbit Monoclonal Id1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

ID1 antibody

70R-49891 100 ul
EUR 244
Description: Purified Polyclonal ID1 antibody

Id1 Antibody

ABD2932 100 ug
EUR 438

Id1 Antibody

49637-100ul 100ul
EUR 333

Id1 Antibody

49637-50ul 50ul
EUR 239

Id1 Antibody

45023-100ul 100ul
EUR 252

Id1 Antibody

45023-50ul 50ul
EUR 187

ID1 antibody

10R-1581 100 ug
EUR 512
Description: Mouse monoclonal ID1 antibody

ID1 antibody

70R-17876 50 ul
EUR 435
Description: Rabbit polyclonal ID1 antibody

Id1 Antibody

DF2932 200ul
EUR 304
Description: Id1 Antibody detects endogenous levels of total Id1.

ID1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ID1. Recognizes ID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Id1 Conjugated Antibody

C45023 100ul
EUR 397

Id1 Conjugated Antibody

C49637 100ul
EUR 397

anti- ID1 antibody

FNab10217 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: DNA-binding protein inhibitor ID-1
  • Uniprot ID: P41134
  • Gene ID: 3397
Description: Antibody raised against ID1

anti- ID1 antibody

FNab04114 100µg
EUR 548.75
  • Immunogen: inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
  • Uniprot ID: P41134
  • Gene ID: 3397
  • Research Area: Stem Cells, Cancer, Metabolism, Developmental biology
Description: Antibody raised against ID1

Anti-ID1 antibody

PAab04114 100 ug
EUR 386

Anti-ID1 antibody

STJ110730 100 µl
EUR 277
Description: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with members of the basic HLH family of transcription factors. The encoded protein has no DNA binding activity and therefore can inhibit the DNA binding and transcriptional activation ability of basic HLH proteins with which it interacts. This protein may play a role in cell growth, senescence, and differentiation. Two transcript variants encoding different isoforms have been found for this gene.

Anti-ID1 antibody

STJ190197 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ID1

Id1/ Rat Id1 ELISA Kit

ELI-08419r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA12521 50 ug
EUR 363
Description: Mouse polyclonal to Id1

Id1 recombinant monoclonal antibody

A5540 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Id1 for WB, IHC, IF,ELISA

ID1 cloning plasmid

CSB-CL010966HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 468
  • Sequence: atgaaagtcgccagtggcagcaccgccaccgccgccgcgggccccagctgcgcgctgaaggccggcaagacagcgagcggtgcgggcgaggtggtgcgctgtctgtctgagcagagcgtggccatctcgcgctgcgccgggggcgccggggcgcgcctgcctgccctgctggacga
  • Show more
Description: A cloning plasmid for the ID1 gene.

ID1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Id1 Blocking Peptide

DF2932-BP 1mg
EUR 195

pcDNA3.1(+)-ID1 Plasmid

PVTB00963-2a 2 ug
EUR 356

pcDNA3.1(+)-ID1 Plasmid

PVTB00963-2b 2 ug
EUR 356


PVT13646 2 ug
EUR 391

Anti-ID1 (2E10)

YF-MA13626 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (4G11)

YF-MA13627 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (5D9)

YF-MA13628 200 ul
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (4G7)

YF-MA13629 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (1B10)

YF-MA13630 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (3A9)

YF-MA13631 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (2C7)

YF-MA13632 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (1D9)

YF-MA13633 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (3F8)

YF-MA13634 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (3F3)

YF-MA13635 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-ID1 (4F6)

YF-MA13636 100 ug
EUR 363
Description: Mouse monoclonal to ID1

Anti-Id1 (1F7)

YF-MA10465 100 ug
EUR 363
Description: Mouse monoclonal to Id1

Rat ID1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF010277 96 Tests
EUR 689

ID1 protein (His tag)

80R-2751 50 ug
EUR 424
Description: Purified recombinant ID1 protein (His tag)

Human ID1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ID1 Recombinant Protein (Human)

RP015526 100 ug Ask for price

ID1 Recombinant Protein (Rat)

RP205430 100 ug Ask for price

ID1 Recombinant Protein (Mouse)

RP142874 100 ug Ask for price

Anti-ID1 (4D7-1A2)

YF-MA13625 200 ul
EUR 363
Description: Mouse monoclonal to ID1

Monoclonal ID1 Antibody (monoclonal) (M02), Clone: 1F7

AMM03647G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ID1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1F7. This antibody is applicable in WB and IF, E

Monoclonal ID1 Antibody (monoclonal) (M04), Clone: 4G11

AMM03648G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ID1 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4G11. This antibody is applicable in WB and IF, E

ID1 ORF Vector (Human) (pORF)

ORF005176 1.0 ug DNA
EUR 95

Id1 ORF Vector (Rat) (pORF)

ORF068478 1.0 ug DNA
EUR 506

Id1 ORF Vector (Mouse) (pORF)

ORF047626 1.0 ug DNA
EUR 506

ID1 ELISA Kit (Human) (OKCA00658)

OKCA00658 96 Wells
EUR 833
Description: Description of target: Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Inhibits skeletal muscle and cardiac myocyte differentiation. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 pg/mL

ID1 ELISA Kit (Mouse) (OKCA01656)

OKCA01656 96 Wells
EUR 846
Description: Description of target: Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Inhibits skeletal muscle and cardiac myocyte differentiation. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.86 pg/mL

ID1 ELISA Kit (Rat) (OKCA01869)

OKCA01869 96 Wells
EUR 846
Description: Description of target: Transcriptional regulator (lacking a basic DNA binding domain) which negatively regulates the basic helix-loop-helix (bHLH) transcription factors by forming heterodimers and inhibiting their DNA binding and transcriptional activity. Implicated in regulating a variety of cellular processes, including cellular growth, senescence, differentiation, apoptosis, angiogenesis, and neoplastic transformation. Inhibits skeletal muscle and cardiac myocyte differentiation. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

ID1 ELISA Kit (Human) (OKEH08357)

OKEH08357 96 Wells
EUR 896
Description: Description of target: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with members of the basic HLH family of transcription factors. The encoded protein has no DNA binding activity and therefore can inhibit the DNA binding and transcriptional activation ability of basic HLH proteins with which it interacts. This protein may play a role in cell growth, senescence, and differentiation. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.159ng/mL

Id1 ELISA Kit (Mouse) (OKEH08358)

OKEH08358 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

ID1 ELISA Kit (Rat) (OKEH08359)

OKEH08359 96 Wells
EUR 896
Description: Description of target: a negative regulator of gene transcription [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082ng/mL

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody

abx026408-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody

abx026408-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (Id1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-1 (ID1) Antibody

abx234114-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

ID1 sgRNA CRISPR Lentivector set (Human)

K1012301 3 x 1.0 ug
EUR 339

Id1 sgRNA CRISPR Lentivector set (Mouse)

K4367701 3 x 1.0 ug
EUR 339

Id1 sgRNA CRISPR Lentivector set (Rat)

K6801201 3 x 1.0 ug
EUR 339

ID1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1012302 1.0 ug DNA
EUR 154

ID1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1012303 1.0 ug DNA
EUR 154

ID1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1012304 1.0 ug DNA
EUR 154

Id1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4367702 1.0 ug DNA
EUR 154

Id1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4367703 1.0 ug DNA
EUR 154

Id1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4367704 1.0 ug DNA
EUR 154

Id1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6801202 1.0 ug DNA
EUR 154

Id1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6801203 1.0 ug DNA
EUR 154

Id1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6801204 1.0 ug DNA
EUR 154

ID1 Protein Vector (Rat) (pPB-C-His)

PV273910 500 ng
EUR 603

ID1 Protein Vector (Rat) (pPB-N-His)

PV273911 500 ng
EUR 603

ID1 Protein Vector (Rat) (pPM-C-HA)

PV273912 500 ng
EUR 603

ID1 Protein Vector (Rat) (pPM-C-His)

PV273913 500 ng
EUR 603

ID1 Protein Vector (Human) (pPB-C-His)

PV020701 500 ng
EUR 329

ID1 Protein Vector (Human) (pPB-N-His)

PV020702 500 ng
EUR 329

ID1 Protein Vector (Human) (pPM-C-HA)

PV020703 500 ng
EUR 329

ID1 Protein Vector (Human) (pPM-C-His)

PV020704 500 ng
EUR 329

ID1 Protein Vector (Mouse) (pPB-C-His)

PV190502 500 ng
EUR 603

ID1 Protein Vector (Mouse) (pPB-N-His)

PV190503 500 ng
EUR 603

ID1 Protein Vector (Mouse) (pPM-C-HA)

PV190504 500 ng
EUR 603

ID1 Protein Vector (Mouse) (pPM-C-His)

PV190505 500 ng
EUR 603

Id1 3'UTR Luciferase Stable Cell Line

TU206077 1.0 ml Ask for price

Id1 3'UTR GFP Stable Cell Line

TU159874 1.0 ml Ask for price

ID1 3'UTR Luciferase Stable Cell Line

TU010400 1.0 ml
EUR 1364

Id1 3'UTR Luciferase Stable Cell Line

TU109874 1.0 ml Ask for price

ID1 3'UTR GFP Stable Cell Line

TU060400 1.0 ml
EUR 1364

Id1 3'UTR GFP Stable Cell Line

TU256077 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC


Scroll to Top