LSM1 Rabbit Polyclonal Antibody

To Order:

LSM1 Polyclonal Antibody

ABP59155-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LSM1 protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of LSM1 from Human, Mouse. This LSM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LSM1 protein at amino acid sequence of 50-130

LSM1 Polyclonal Antibody

ABP59155-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LSM1 protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of LSM1 from Human, Mouse. This LSM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LSM1 protein at amino acid sequence of 50-130

LSM1 Polyclonal Antibody

ES9022-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LSM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LSM1 Polyclonal Antibody

ES9022-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LSM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LSM1 Rabbit pAb

A12732-100ul 100 ul
EUR 308

LSM1 Rabbit pAb

A12732-200ul 200 ul
EUR 459

LSM1 Rabbit pAb

A12732-20ul 20 ul
EUR 183

LSM1 Rabbit pAb

A12732-50ul 50 ul
EUR 223

LSM1 Rabbit pAb

A5976-100ul 100 ul
EUR 308

LSM1 Rabbit pAb

A5976-200ul 200 ul
EUR 459

LSM1 Rabbit pAb

A5976-20ul 20 ul Ask for price

LSM1 Rabbit pAb

A5976-50ul 50 ul Ask for price

LSM1 antibody

70R-18318 50 ul
EUR 435
Description: Rabbit polyclonal LSM1 antibody

LSM1 antibody

10R-4716 100 ul
EUR 691
Description: Mouse monoclonal LSM1 antibody

LSM1 antibody

10R-4718 100 ul
EUR 726
Description: Mouse monoclonal LSM1 antibody

LSM1 antibody

10R-4719 100 ul
EUR 691
Description: Mouse monoclonal LSM1 antibody

LSM1 Antibody

45470-100ul 100ul
EUR 252

LSM1 Antibody

45470-50ul 50ul
EUR 187

LSM1 Antibody

DF8754 200ul
EUR 304
Description: LSM1 Antibody detects endogenous levels of total LSM1.

LSM1 antibody

70R-4947 50 ug
EUR 467
Description: Rabbit polyclonal LSM1 antibody

LSM1 antibody

70R-51377 100 ul
EUR 244
Description: Purified Polyclonal LSM1 antibody

LSM1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

LSM1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LSM1 Antibody

ABD8754 100 ug
EUR 438

LSM1 Polyclonal Antibody, HRP Conjugated

A62903 100 µg
EUR 570.55
Description: fast delivery possible

LSM1 Polyclonal Antibody, FITC Conjugated

A62904 100 µg
EUR 570.55
Description: reagents widely cited

LSM1 Polyclonal Antibody, Biotin Conjugated

A62905 100 µg
EUR 570.55
Description: Ask the seller for details

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

abx145171-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

abx031756-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

abx031756-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

abx031757-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

abx031757-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

abx234870-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human LSM1 Antibody

33168-05111 150 ug
EUR 261

LSM1 Conjugated Antibody

C45470 100ul
EUR 397

anti- LSM1 antibody

FNab04870 100µg
EUR 505.25
  • Immunogen: LSM1 homolog, U6 small nuclear RNA associated(S. cerevisiae)
  • Uniprot ID: O15116
  • Gene ID: 27257
  • Research Area: Metabolism
Description: Antibody raised against LSM1

Anti-LSM1 antibody

PAab04870 100 ug
EUR 355

Anti-LSM1 antibody

STJ27772 100 µl
EUR 277
Description: This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Increased expression of this gene may play a role in cellular transformation and the progression of several malignancies including lung cancer, mesothelioma and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9.

Anti-LSM1 antibody

STJ114605 100 µl
EUR 277
Description: This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Increased expression of this gene may play a role in cellular transformation and the progression of several malignancies including lung cancer, mesothelioma and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9.

Anti-LSM1 antibody

STJ190180 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LSM1

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LSM1 Homolog, mRNA Degradation Associated (LSM1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA18443 50 ug
EUR 363
Description: Mouse polyclonal to LSM1

LSM1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LSM1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LSM1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSM1. Recognizes LSM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LSM1 Homolog, mRNA Degradation Associated (LSM1) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

LSM1 Blocking Peptide

33R-8375 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LSM1 antibody, catalog no. 70R-4947

LSM1 Blocking Peptide

DF8754-BP 1mg
EUR 195

LSM1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

LSM1 cloning plasmid

CSB-CL013199HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 402
  • Sequence: atgaactatatgcctggcaccgccagcctcatcgaggacattgacaaaaagcacttggttctgcttcgagatggaaggacacttataggctttttaagaagcattgatcaatttgcaaacttagtgctacatcagactgtggagcgtattcatgtgggcaaaaaatacggtgatat
  • Show more
Description: A cloning plasmid for the LSM1 gene.

Anti-LSM1 (4F7)

YF-MA18190 100 ug
EUR 363
Description: Mouse monoclonal to LSM1

Human LSM1 Antibody (Biotin Conjugate)

33168-05121 150 ug
EUR 369

Human LSM1 Homolog, mRNA Degradation Associated (LSM1) ELISA Kit

abx388331-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human LSM1 AssayLite Antibody (FITC Conjugate)

33168-05141 150 ug
EUR 428

Human LSM1 AssayLite Antibody (RPE Conjugate)

33168-05151 150 ug
EUR 428

Human LSM1 AssayLite Antibody (APC Conjugate)

33168-05161 150 ug
EUR 428

Human LSM1 AssayLite Antibody (PerCP Conjugate)

33168-05171 150 ug
EUR 471

LSM1 protein (His tag)

80R-1496 100 ug
EUR 305
Description: Purified recombinant Human LSM1 protein


EF010738 96 Tests
EUR 689


ELI-45831b 96 Tests
EUR 928

Mouse LSM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LSM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LSM1 Recombinant Protein (Human)

RP018349 100 ug Ask for price

LSM1 Recombinant Protein (Mouse)

RP148475 100 ug Ask for price

LSM1 Recombinant Protein (Rat)

RP210182 100 ug Ask for price

Mouse U6 snRNA- associated Sm- like protein LSm1, Lsm1 ELISA KIT

ELI-19541m 96 Tests
EUR 865

Human U6 snRNA- associated Sm- like protein LSm1, LSM1 ELISA KIT

ELI-27772h 96 Tests
EUR 824

Recombinant Human U6 snRNA-Associated Sm-Like Protein LSm1/LSM1 (C-6His)

C262-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human U6 snRNA-Associated Sm-Like Protein LSm1/LSM1 (C-6His)

C262-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human U6 snRNA-Associated Sm-Like Protein LSm1/LSM1 (C-6His)

C262-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human U6 snRNA-Associated Sm-Like Protein LSm1/LSM1 (C-6His)

C262-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Lsm1 ORF Vector (Rat) (pORF)

ORF070062 1.0 ug DNA
EUR 506

LSM1 ORF Vector (Human) (pORF)

ORF006117 1.0 ug DNA
EUR 95

Lsm1 ORF Vector (Mouse) (pORF)

ORF049493 1.0 ug DNA
EUR 506

Lsm1 sgRNA CRISPR Lentivector set (Mouse)

K4940901 3 x 1.0 ug
EUR 339

Lsm1 sgRNA CRISPR Lentivector set (Rat)

K6324001 3 x 1.0 ug
EUR 339

LSM1 sgRNA CRISPR Lentivector set (Human)

K1240701 3 x 1.0 ug
EUR 339

Lsm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4940902 1.0 ug DNA
EUR 154

Lsm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4940903 1.0 ug DNA
EUR 154

Lsm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4940904 1.0 ug DNA
EUR 154


Scroll to Top