MAP4 Rabbit Polyclonal Antibody

To Order:

MAP4 Polyclonal Antibody

ES8897-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MAP4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAP4 Rabbit pAb

A5906-100ul 100 ul
EUR 308

MAP4 Rabbit pAb

A5906-200ul 200 ul
EUR 459

MAP4 Rabbit pAb

A5906-20ul 20 ul
EUR 183

MAP4 Rabbit pAb

A5906-50ul 50 ul
EUR 223

MAP4 Rabbit pAb

A17421-100ul 100 ul Ask for price

MAP4 Rabbit pAb

A17421-200ul 200 ul Ask for price

MAP4 Rabbit pAb

A17421-20ul 20 ul Ask for price

MAP4 Rabbit pAb

A17421-50ul 50 ul
EUR 384

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit

DLR-MAP4-Hu-48T 48T
EUR 498
  • Should the Human Microtubule Associated Protein 4 (MAP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microtubule Associated Protein 4 (MAP4) in samples from tissue homogenates or other biological fluids.

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit

DLR-MAP4-Hu-96T 96T
EUR 647
  • Should the Human Microtubule Associated Protein 4 (MAP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microtubule Associated Protein 4 (MAP4) in samples from tissue homogenates or other biological fluids.

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit

DLR-MAP4-Ra-48T 48T
EUR 528
  • Should the Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Microtubule Associated Protein 4 (MAP4) in samples from tissue homogenates or other biological fluids.

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit

DLR-MAP4-Ra-96T 96T
EUR 690
  • Should the Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Microtubule Associated Protein 4 (MAP4) in samples from tissue homogenates or other biological fluids.

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit

RDR-MAP4-Hu-48Tests 48 Tests
EUR 522

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit

RDR-MAP4-Hu-96Tests 96 Tests
EUR 724

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit

RDR-MAP4-Ra-48Tests 48 Tests
EUR 558

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit

RDR-MAP4-Ra-96Tests 96 Tests
EUR 776

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit

RD-MAP4-Hu-48Tests 48 Tests
EUR 500

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit

RD-MAP4-Hu-96Tests 96 Tests
EUR 692

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit

RD-MAP4-Ra-48Tests 48 Tests
EUR 534

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit

RD-MAP4-Ra-96Tests 96 Tests
EUR 742

MAP4 antibody

70R-18393 50 ul
EUR 435
Description: Rabbit polyclonal MAP4 antibody

MAP4 antibody

70R-10032 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MAP4 antibody

MAP4 Antibody

35949-100ul 100ul
EUR 252

MAP4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

MAP4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

MAP4 antibody

70R-36731 100 ug
EUR 327
Description: Rabbit Polyclonal MAP4 antibody

MAP4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MAP4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MAP4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000


B6414-10 10 mg
EUR 383


B6414-50 50 mg
EUR 1455

MAP4 (Phospho-Ser696) Polyclonal Conjugated Antibody

C12448 100ul
EUR 397

MAP4 (pS696) Antibody

abx216702-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

MAP4 Conjugated Antibody

C35949 100ul
EUR 397

anti- MAP4 antibody

FNab04979 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:500-1:5000
  • IHC: 1:50-1:500
  • Immunogen: microtubule-associated protein 4
  • Uniprot ID: P27816
  • Gene ID: 4134
  • Research Area: cancer, Neuroscience, Metabolism, Signal Transduction
Description: Antibody raised against MAP4

Anti-MAP4 antibody

PAab04979 100 ug
EUR 355

Anti-MAP4 antibody

STJ116286 100 µl
EUR 277
Description: The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-MAP4 antibody

STJ119542 50 µl
EUR 393
Description: The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-MAP4 antibody

STJ99615 200 µl
EUR 197
Description: Rabbit polyclonal to MAP4.

Map4/ Rat Map4 ELISA Kit

ELI-23697r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAP4 (Phospho-Ser696) Antibody

12448-100ul 100ul
EUR 252

MAP4 (Phospho-Ser696) Antibody

12448-50ul 50ul
EUR 187

MAP4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAP4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAP4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-MAP4 (S696) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-MAP4 (S696). Recognizes Phospho-MAP4 (S696) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

Phospho-MAP4 (Ser696) Antibody

AF8075 200ul
EUR 376
Description: MAP4 (Phospho-Ser696) Antibody detects endogenous levels of MAP4 only when phosphorylated at Ser696.

MAP4 (Phospho- Ser696) Antibody

ABF8075 100 ug
EUR 438

pCT-MAP4-GFP (pCMV, Microtubules, MAP4 Tag)

CYTO112-PA-1 10 ug
EUR 684
  • Category: Bioluminescent Imaging

pCT-MAP4-GFP (pCMV, Microtubules, MAP4 Tag)

CYTO112-VA-1 >2x10^6 IFUs
EUR 781
  • Category: Bioluminescent Imaging

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Thr882~Glu1062)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4)

MAP4 Blocking Peptide

33R-5085 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAP4 antibody, catalog no. 70R-10032

MAP4 cloning plasmid

CSB-CL013435HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2940
  • Sequence: atggctgacctcagtcttgcagatgcattaacagaaccatctccagacattgagggagagataaagcgggacttcattgccacactagaggcagaggcctttgatgatgttgtgggagaaactgttggaaaaacagactatattcctctcctggatgttgatgagaaaaccggga
  • Show more
Description: A cloning plasmid for the MAP4 gene.

pSV40- Map4- m

PVT11650 2 ug
EUR 273

Anti-MAP4 (7C9)

YF-MA14125 100 ug
EUR 363
Description: Mouse monoclonal to MAP4

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Thr882~Glu1062)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Thr882~Glu1062)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Biotin.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Thr882~Glu1062)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Cy3.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Thr882~Glu1062)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with FITC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Thr882~Glu1062)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with HRP.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Thr882~Glu1062)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with PE.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat)

  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Ala2~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4)

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody

abx234979-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Met243~Val549)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4)

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Thr882~Glu1062)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC-Cy7.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), APC

  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Ala2~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Ala2~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Biotin.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Ala2~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Cy3.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), FITC

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Ala2~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with FITC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), HRP

  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Ala2~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with HRP.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), PE

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Ala2~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with PE.


EF010818 96 Tests
EUR 689

Rat MAP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MAP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MAP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Met243~Val549)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Met243~Val549)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Biotin.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Met243~Val549)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Cy3.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Met243~Val549)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with FITC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Met243~Val549)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with HRP.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Met243~Val549)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with PE.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Ala2~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC-Cy7.

Microtubule Associated Protein 4 (MAP4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospho-MAP4 (Ser696) Blocking Peptide

AF8075-BP 1mg
EUR 195

Map4 ORF Vector (Rat) (pORF)

ORF070253 1.0 ug DNA
EUR 506

MAP4 ORF Vector (Human) (pORF)

ORF006254 1.0 ug DNA
EUR 95

MAP4 ELISA Kit (Human) (OKCD00829)

OKCD00829 96 Wells
EUR 792
Description: Description of target: Non-neuronal microtubule-associated protein. Promotes microtubule assembly.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.11"Ser787 in the proline-rich region of human MAP4 is a critical phosphorylation site that reduces its activity to promote tubulin polymerization."_x005F_x005F_x000D_Kitazawa H., Iida J., Uchida A., Haino-Fukushima K., Itoh T.J., Hotani H., Ookata K., Murofushi H., Bulinski J.C., Kishimoto T., Hisanaga S._x005F_x005F_x000D_Cell Struct. Funct. 25:33-39(2000) [PubMed] [Europe PMC] [Abstract]Cited for: PHOSPHORYLATION AT SER-696 AND SER-787, FUNCTION, MUTAGENESIS OF SER-696 AND SER-787. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.101 ng/mL

MAP4 ELISA Kit (Rat) (OKCD00830)

OKCD00830 96 Wells
EUR 857
Description: Description of target: Non-neuronal microtubule-associated protein. Promotes microtubule assembly (By similarity).By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.123 ng/mL

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MAP4 (Met243~Val549)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC-Cy7.

Map4 sgRNA CRISPR Lentivector set (Rat)

K6337501 3 x 1.0 ug
EUR 339

MAP4 sgRNA CRISPR Lentivector set (Human)

K1264701 3 x 1.0 ug
EUR 339

Recombinant Microtubule Associated Protein 4 (MAP4)

  • EUR 462.88
  • EUR 227.00
  • EUR 1460.80
  • EUR 553.60
  • EUR 1007.20
  • EUR 373.00
  • EUR 3502.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P27816
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 63.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Microtubule Associated Protein 4 expressed in: E.coli

Recombinant Microtubule Associated Protein 4 (MAP4)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P27546
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.3kDa
  • Isoelectric Point: 10.2
Description: Recombinant Mouse Microtubule Associated Protein 4 expressed in: E.coli

Recombinant Microtubule Associated Protein 4 (MAP4)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5M7W5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.7kDa
  • Isoelectric Point: 4.2
Description: Recombinant Rat Microtubule Associated Protein 4 expressed in: E.coli

Microtubule Associated Protein 4 Phospho-Ser696 (MAP4 pS696) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Microtubule Associated Protein 4 (MAP4) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Microtubule Associated Protein 4 (MAP4) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Microtubule Associated Protein 4 (MAP4) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1970.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Map4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6337502 1.0 ug DNA
EUR 154

Map4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6337503 1.0 ug DNA
EUR 154

Map4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6337504 1.0 ug DNA
EUR 154

MAP4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1264702 1.0 ug DNA
EUR 154

MAP4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1264703 1.0 ug DNA
EUR 154

MAP4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1264704 1.0 ug DNA
EUR 154

MAP4 Protein Vector (Human) (pPB-C-His)

PV025013 500 ng
EUR 329

MAP4 Protein Vector (Human) (pPB-N-His)

PV025014 500 ng
EUR 329

MAP4 Protein Vector (Human) (pPM-C-HA)

PV025015 500 ng
EUR 329

MAP4 Protein Vector (Human) (pPM-C-His)

PV025016 500 ng
EUR 329

MAP4 Protein Vector (Rat) (pPB-C-His)

PV281010 500 ng
EUR 1191

MAP4 Protein Vector (Rat) (pPB-N-His)

PV281011 500 ng
EUR 1191

MAP4 Protein Vector (Rat) (pPM-C-HA)

PV281012 500 ng
EUR 1191

MAP4 Protein Vector (Rat) (pPM-C-His)

PV281013 500 ng
EUR 1191

Map4 3'UTR Luciferase Stable Cell Line

TU212836 1.0 ml Ask for price

Map4 3'UTR GFP Stable Cell Line

TU262836 1.0 ml Ask for price

MAP4 3'UTR GFP Stable Cell Line

TU062963 1.0 ml
EUR 2333

MAP4 3'UTR Luciferase Stable Cell Line

TU012963 1.0 ml
EUR 2333

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187


Scroll to Top