MTF1 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

MTF1 Polyclonal Antibody

ABP59334-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MTF1 protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of MTF1 from Human, Mouse. This MTF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MTF1 protein at amino acid sequence of 260-340

MTF1 Polyclonal Antibody

ABP59334-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MTF1 protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of MTF1 from Human, Mouse. This MTF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MTF1 protein at amino acid sequence of 260-340

MTF1 Polyclonal Antibody

ABP59334-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MTF1 protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of MTF1 from Human, Mouse. This MTF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MTF1 protein at amino acid sequence of 260-340

MTF1 Antibody

ABD8827 100 ug
EUR 438

MTF1 Antibody

45522-100ul 100ul
EUR 252

MTF1 Antibody

45522-50ul 50ul
EUR 187

MTF1 Antibody

DF8827 200ul
EUR 304
Description: MTF1 Antibody detects endogenous levels of total MTF1.

MTF1 Conjugated Antibody

C45522 100ul
EUR 397

anti- MTF1 antibody

FNab05396 100µg
EUR 548.75
  • Immunogen: metal-regulatory transcription factor 1
  • Uniprot ID: Q14872
  • Gene ID: 4520
  • Research Area: Metabolism
Description: Antibody raised against MTF1

Anti-MTF1 antibody

PAab05396 100 ug
EUR 386

Anti-MTF1 antibody

STJ190218 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MTF1

MTF1 siRNA

20-abx924891
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MTF1 siRNA

20-abx924892
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MTF1

YF-PA24176 50 ul
EUR 334
Description: Mouse polyclonal to MTF1

MTF1 Blocking Peptide

DF8827-BP 1mg
EUR 195

MTF1 cloning plasmid

CSB-CL619895HU-10ug 10ug
EUR 742
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2262
  • Sequence: atgggggaacacagtccagacaacaacatcatctactttgaggcagaggaagatgagctgacccccgatgataaaatgctcaggtttgtggataaaaacggactggtgccttcctcatctggaactgtttatgataggaccactgttcttattgagcaggaccctggcactttgg
  • Show more
Description: A cloning plasmid for the MTF1 gene.

Anti-MTF1 (2E5)

YF-MA14313 100 ug
EUR 363
Description: Mouse monoclonal to MTF1

Anti-MTF1 (2C12)

YF-MA14314 100 ug
EUR 363
Description: Mouse monoclonal to MTF1

Anti-MTF1 (3G12)

YF-MA14315 100 ug
EUR 363
Description: Mouse monoclonal to MTF1

Anti-MTF1 (4A5)

YF-MA14316 200 ul
EUR 363
Description: Mouse monoclonal to MTF1

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human)

4-PAC633Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~His164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1)

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse)

4-PAC633Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~Tyr139)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1)

Human MTF1 ELISA Kit

ELA-E11998h 96 Tests
EUR 824

MTF1 ELISA KIT|Human

EF004340 96 Tests
EUR 689

Human MTF1 shRNA Plasmid

20-abx952999
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MTF1 shRNA Plasmid

20-abx971610
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MTF1 Recombinant Protein (Human)

RP020269 100 ug Ask for price

MTF1 Recombinant Protein (Rat)

RP212648 100 ug Ask for price

MTF1 Recombinant Protein (Mouse)

RP152021 100 ug Ask for price

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), APC

4-PAC633Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~His164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with APC.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), Biotinylated

4-PAC633Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~His164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with Biotin.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), Cy3

4-PAC633Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~His164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with Cy3.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), FITC

4-PAC633Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~His164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with FITC.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), HRP

4-PAC633Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~His164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with HRP.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), PE

4-PAC633Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~His164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with PE.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), APC

4-PAC633Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~Tyr139)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with APC.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), Biotinylated

4-PAC633Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~Tyr139)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with Biotin.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), Cy3

4-PAC633Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~Tyr139)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with Cy3.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), FITC

4-PAC633Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~Tyr139)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with FITC.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), HRP

4-PAC633Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~Tyr139)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with HRP.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), PE

4-PAC633Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~Tyr139)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with PE.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), APC-Cy7

4-PAC633Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~His164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with APC-Cy7.

Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC633Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MTF1 (Gly2~Tyr139)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with APC-Cy7.

Metal Regulatory Transcription Factor 1 (MTF1) Antibody

20-abx131698
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Metal Regulatory Transcription Factor 1 (MTF1) Antibody

20-abx131699
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Metal Regulatory Transcription Factor 1 (MTF1) Antibody

20-abx216963
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Metal Regulatory Transcription Factor 1 (MTF1) Antibody

abx235396-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

MTF1 ORF Vector (Human) (pORF)

ORF006757 1.0 ug DNA
EUR 95

Mtf1 ORF Vector (Mouse) (pORF)

ORF050675 1.0 ug DNA
EUR 506

Mtf1 ORF Vector (Rat) (pORF)

ORF070884 1.0 ug DNA
EUR 506

MTF1 ELISA Kit (Human) (OKEH02198)

OKEH02198 96 Wells
EUR 662
Description: Description of target: This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE).;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL

Mtf1 sgRNA CRISPR Lentivector set (Mouse)

K3833001 3 x 1.0 ug
EUR 339

MTF1 sgRNA CRISPR Lentivector set (Human)

K1359901 3 x 1.0 ug
EUR 339

Mtf1 sgRNA CRISPR Lentivector set (Rat)

K6559301 3 x 1.0 ug
EUR 339

Mtf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3833002 1.0 ug DNA
EUR 154

Mtf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3833003 1.0 ug DNA
EUR 154

Mtf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3833004 1.0 ug DNA
EUR 154

MTF1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1359902 1.0 ug DNA
EUR 154

MTF1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1359903 1.0 ug DNA
EUR 154

MTF1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1359904 1.0 ug DNA
EUR 154

Mtf1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6559302 1.0 ug DNA
EUR 154

Mtf1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6559303 1.0 ug DNA
EUR 154

Mtf1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6559304 1.0 ug DNA
EUR 154

Recombinant Metal Regulatory Transcription Factor 1 (MTF1)

4-RPC633Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q14872
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Metal Regulatory Transcription Factor 1 expressed in: E.coli

Recombinant Metal Regulatory Transcription Factor 1 (MTF1)

4-RPC633Mu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q07243
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Metal Regulatory Transcription Factor 1 expressed in: E.coli

MTF1 Protein Vector (Rat) (pPB-C-His)

PV283534 500 ng
EUR 1191

MTF1 Protein Vector (Rat) (pPB-N-His)

PV283535 500 ng
EUR 1191

MTF1 Protein Vector (Rat) (pPM-C-HA)

PV283536 500 ng
EUR 1191

MTF1 Protein Vector (Rat) (pPM-C-His)

PV283537 500 ng
EUR 1191

MTF1 Protein Vector (Human) (pPB-C-His)

PV027025 500 ng
EUR 329

MTF1 Protein Vector (Human) (pPB-N-His)

PV027026 500 ng
EUR 329

MTF1 Protein Vector (Human) (pPM-C-HA)

PV027027 500 ng
EUR 329

MTF1 Protein Vector (Human) (pPM-C-His)

PV027028 500 ng
EUR 329

MTF1 Protein Vector (Mouse) (pPB-C-His)

PV202698 500 ng
EUR 1065

MTF1 Protein Vector (Mouse) (pPB-N-His)

PV202699 500 ng
EUR 1065

MTF1 Protein Vector (Mouse) (pPM-C-HA)

PV202700 500 ng
EUR 1065

MTF1 Protein Vector (Mouse) (pPM-C-His)

PV202701 500 ng
EUR 1065

Mtf1 3'UTR GFP Stable Cell Line

TU163568 1.0 ml Ask for price

Mtf1 3'UTR Luciferase Stable Cell Line

TU213517 1.0 ml Ask for price

MTF1 3'UTR Luciferase Stable Cell Line

TU014873 1.0 ml
EUR 1394

Mtf1 3'UTR Luciferase Stable Cell Line

TU113568 1.0 ml Ask for price

MTF1 3'UTR GFP Stable Cell Line

TU064873 1.0 ml
EUR 1394

Mtf1 3'UTR GFP Stable Cell Line

TU263517 1.0 ml Ask for price

Human Metal Regulatory Transcription Factor 1 (MTF1) Protein

20-abx650086
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Metal Regulatory Transcription Factor 1 (MTF1) Protein

20-abx650087
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MTF1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV792139 1.0 ug DNA
EUR 316

MTF1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV792140 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

 

Scroll to Top