MYL2 Rabbit Polyclonal Antibody

To Order:

MYL2 Polyclonal Antibody

ABP59368-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of MYL2 from Human, Mouse, Rat. This MYL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140

MYL2 Polyclonal Antibody

ABP59368-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of MYL2 from Human, Mouse, Rat. This MYL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140

MYL2 Polyclonal Antibody

ABP59368-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of MYL2 from Human, Mouse, Rat. This MYL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140

MYL2 Polyclonal Antibody

ES8862-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYL2 Polyclonal Antibody

ES8862-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYL2 Rabbit pAb

A14188-100ul 100 ul
EUR 308

MYL2 Rabbit pAb

A14188-200ul 200 ul
EUR 459

MYL2 Rabbit pAb

A14188-20ul 20 ul
EUR 183

MYL2 Rabbit pAb

A14188-50ul 50 ul
EUR 223

MYL2 Rabbit pAb

A5473-100ul 100 ul
EUR 308

MYL2 Rabbit pAb

A5473-200ul 200 ul
EUR 459

MYL2 Rabbit pAb

A5473-20ul 20 ul
EUR 183

MYL2 Rabbit pAb

A5473-50ul 50 ul
EUR 223

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit

DLR-MYL2-Hu-48T 48T
EUR 498
  • Should the Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit

DLR-MYL2-Hu-96T 96T
EUR 647
  • Should the Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit

RDR-MYL2-Hu-48Tests 48 Tests
EUR 522

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit

RDR-MYL2-Hu-96Tests 96 Tests
EUR 724

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit

RD-MYL2-Hu-48Tests 48 Tests
EUR 500

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit

RD-MYL2-Hu-96Tests 96 Tests
EUR 692

MYL2 antibody

70R-18708 50 ul
EUR 435
Description: Rabbit polyclonal MYL2 antibody

MYL2 Antibody

35826-100ul 100ul
EUR 252

MYL2 antibody

38662-100ul 100ul
EUR 252

MYL2 antibody

10R-2043 100 ul
EUR 349
Description: Mouse monoclonal MYL2 antibody

MYL2 antibody

10R-1148 100 ul
EUR 316
Description: Mouse monoclonal MYL2 antibody

MYL2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MYL2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

MYL2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MYL2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

MYL2 Antibody

ABD7911 100 ug
EUR 438

MYL2 Antibody

ABD8007 100 ug
EUR 438

MYL2 Polyclonal Antibody, HRP Conjugated

A64121 100 µg
EUR 570.55
Description: reagents widely cited

MYL2 Polyclonal Antibody, FITC Conjugated

A64122 100 µg
EUR 570.55
Description: Ask the seller for details

MYL2 Polyclonal Antibody, Biotin Conjugated

A64123 100 µg
EUR 570.55
Description: The best epigenetics products

Human MYL2 Antibody

32598-05111 150 ug
EUR 261

MYL2 Conjugated Antibody

C35826 100ul
EUR 397

MYL2 Conjugated Antibody

C38662 100ul
EUR 397

anti- MYL2 antibody

FNab05486 100µg
EUR 585
  • Immunogen: myosin, light chain 2, regulatory, cardiac, slow
  • Uniprot ID: P10916
  • Gene ID: 4633
  • Research Area: Neuroscience, Immunology, Cardiovascular
Description: Antibody raised against MYL2

Anti-MYL2 antibody

PAab05486 100 ug
EUR 412

Anti-MYL2 antibody

STJ27426 100 µl
EUR 277
Description: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.

Anti-MYL2 antibody

STJ116121 100 µl
EUR 277
Description: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.

Anti-MYL2 antibody

STJ98260 100 µl
EUR 234
Description: Mouse monoclonal to MYL2.

Anti-MYL2 antibody

STJ99335 200 µl
EUR 197
Description: Rabbit polyclonal to MYL2.

Myl2/ Rat Myl2 ELISA Kit

ELI-43717r 96 Tests
EUR 886

MYL2 protein

30R-3236 50 ug
EUR 257
Description: Purified recombinant MYL2 protein


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Anti-MYL2 monoclonal antibody, clone TO78-10

DCABH-2673 100 ul
EUR 777

MYL2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MYL2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MYL2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MYL2 Monoclonal Antibody

A03215 100ul
EUR 397
Description: Mouse Monoclonal Antibody for MYL2 Antibody (MYL2) detection. Tested with WB in Human.

MYL2 cloning plasmid

CSB-CL015309HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 501
  • Sequence: atggcacctaagaaagcaaagaagagagccgggggcgccaactccaacgtgttctccatgttcgaacagacccaaatccaggaatttaaggaggccttcactatcatggaccagaacagggatggcttcattgacaagaacgatctgagagacacctttgctgcccttgggcgagt
  • Show more
Description: A cloning plasmid for the MYL2 gene.

anti-MYL2 (7C9)

LF-MA30265 100 ul
EUR 445
Description: Mouse Monoclonal to MYL2

Human MYL2 Antibody (Biotin Conjugate)

32598-05121 150 ug
EUR 369

Monoclonal MYL2 Antibody, Clone: 7C9

APR08594G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human MYL2. The antibodies are raised in Mouse and are from clone 7C9. This antibody is applicable in WB, E

Human MYL2 AssayLite Antibody (FITC Conjugate)

32598-05141 150 ug
EUR 428

Human MYL2 AssayLite Antibody (RPE Conjugate)

32598-05151 150 ug
EUR 428

Human MYL2 AssayLite Antibody (APC Conjugate)

32598-05161 150 ug
EUR 428

Human MYL2 AssayLite Antibody (PerCP Conjugate)

32598-05171 150 ug
EUR 471

MYL2 protein (His tag)

80R-1085 100 ug
EUR 305
Description: Purified recombinant Human MYL2 protein


ELI-23480h 96 Tests
EUR 824


EF001031 96 Tests
EUR 689


ELI-45570b 96 Tests
EUR 928

Rat MYL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MYL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MYL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Myl2 ELISA KIT

ELI-36623m 96 Tests
EUR 865

MYL2 Recombinant Protein (Human)

RP020497 100 ug Ask for price

MYL2 Recombinant Protein (Mouse)

RP152612 100 ug Ask for price

MYL2 Recombinant Protein (Rat)

RP212966 100 ug Ask for price

Monoclonal MYL2 Antibody (clone AT3B2), Clone: AT3B2

AMM01832G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human MYL2 (clone AT3B2). The antibodies are raised in Mouse and are from clone AT3B2. This antibody is applicable in WB and IHC-P, E

Monoclonal MYL2 Antibody (clone 7C9), Clone: 7C9

AMM02192G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human MYL2 (clone 7C9). The antibodies are raised in Mouse and are from clone 7C9. This antibody is applicable in WB and IHC-P, E

Myl2 ORF Vector (Rat) (pORF)

ORF070990 1.0 ug DNA
EUR 506

MYL2 ORF Vector (Human) (pORF)

ORF006833 1.0 ug DNA
EUR 95

Myl2 ORF Vector (Mouse) (pORF)

ORF050872 1.0 ug DNA
EUR 506

MYL2 ELISA Kit (Human) (OKAN06018)

OKAN06018 96 Wells
EUR 792
Description: Description of target: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.1 pg/mL

MYL2 ELISA Kit (Mouse) (OKCA01725)

OKCA01725 96 Wells
EUR 846
Description: Description of target: Contractile protein that plays a role in heart development and function (PubMed:10409661). Following phosphorylation, plays a role in cross-bridge cycling kinetics and cardiac muscle contraction by increasing myosin lever arm stiffness and promoting myosin head diffusion; as a consequence of the increase in maximum contraction force and calcium sensitivity of contraction force. These events altogether slow down myosin kinetics and prolong duty cycle resulting in accumulated myosins being cooperatively recruited to actin binding sites to sustain thin filament activation as a means to fine-tune myofilament calcium sensitivity to force (PubMed:22426213, PubMed:16908724, PubMed:10409661). During cardiogenesis plays an early role in cardiac contractility by promoting cardiac myofibril assembly (PubMed:9422794).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

MYL2 ELISA Kit (Human) (OKCD07142)

OKCD07142 96 Wells
EUR 936
Description: Description of target: Mouse Anti Human Myosin Light Chain 2;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 3.1pg/mL

MYL2 ELISA Kit (Human) (OKDD00413)

OKDD00413 96 Wells
EUR 923
Description: Description of target: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

abx011220-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

abx235486-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myl2 sgRNA CRISPR Lentivector set (Mouse)

K4687201 3 x 1.0 ug
EUR 339

Myl2 sgRNA CRISPR Lentivector set (Rat)

K6363501 3 x 1.0 ug
EUR 339

MYL2 sgRNA CRISPR Lentivector set (Human)

K1375401 3 x 1.0 ug
EUR 339

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2)

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with APC.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with Biotin.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with Cy3.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with FITC.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with HRP.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with PE.

Myl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4687202 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4687203 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4687204 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6363502 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6363503 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6363504 1.0 ug DNA
EUR 154

MYL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1375402 1.0 ug DNA
EUR 154

MYL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1375403 1.0 ug DNA
EUR 154

MYL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1375404 1.0 ug DNA
EUR 154


Scroll to Top