PCBP1 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

PCBP1 Polyclonal Antibody
A64658 100 µg
EUR 570.55
Description: reagents widely cited

PCBP1 Polyclonal Antibody
ABP59842-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PCBP1 from Human, Mouse. This PCBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110

PCBP1 Polyclonal Antibody
ABP59842-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PCBP1 from Human, Mouse. This PCBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110

PCBP1 Polyclonal Antibody
ABP59842-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PCBP1 from Human, Mouse. This PCBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCBP1 protein at amino acid sequence of 30-110

PCBP1 Polyclonal Antibody
ES9064-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PCBP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PCBP1 Polyclonal Antibody
ES9064-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PCBP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PCBP1 Rabbit pAb
A1044-100ul 100 ul
EUR 308

PCBP1 Rabbit pAb
A1044-200ul 200 ul
EUR 459

PCBP1 Rabbit pAb
A1044-20ul 20 ul
EUR 183

PCBP1 Rabbit pAb
A1044-50ul 50 ul
EUR 223

PCBP1 Polyclonal Conjugated Antibody
C27441 100ul
EUR 397

PCBP1 antibody
70R-1466 100 ug
EUR 377
Description: Rabbit polyclonal PCBP1 antibody

PCBP1 antibody
10R-10236 50 ul
EUR 241
Description: Mouse monoclonal PCBP1 antibody

PCBP1 Antibody
39508-100ul 100ul
EUR 390

PCBP1 Antibody
1-CSB-PA613590LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

PCBP1 Antibody
1-CSB-PA017516GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PCBP1 antibody
70R-4995 50 ug
EUR 467
Description: Rabbit polyclonal PCBP1 antibody

Rabbit PCBP1 ELISA kit
ELI-45079Ra 96 Tests
EUR 928

PCBP1 Polyclonal Antibody, HRP Conjugated
A64659 100 µg
EUR 570.55
Description: Ask the seller for details

PCBP1 Polyclonal Antibody, FITC Conjugated
A64660 100 µg
EUR 570.55
Description: The best epigenetics products

PCBP1 Polyclonal Antibody, Biotin Conjugated
A64661 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-PCBP1 antibody
STJ111059 100 µl
EUR 277
Description: This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability.

Anti-PCBP1 antibody
STJ190222 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PCBP1

PCBP1 siRNA
20-abx927847
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCBP1 siRNA
20-abx927848
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PCBP1
YF-PA24311 50 ul
EUR 334
Description: Mouse polyclonal to PCBP1

PCBP1 Antibody, HRP conjugated
1-CSB-PA613590LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PCBP1 Antibody, FITC conjugated
1-CSB-PA613590LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PCBP1 Antibody, Biotin conjugated
1-CSB-PA613590LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP1. Recognizes PCBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PCBP1 Blocking Peptide
33R-1804 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP1 antibody, catalog no. 70R-1466

PCBP1 Blocking Peptide
33R-7142 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP1 antibody, catalog no. 70R-4995

PCBP1 cloning plasmid
CSB-CL613590HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atggatgccggtgtgactgaaagtggactaaatgtgactctcaccattcggcttcttatgcacggaaaggaagtaggaagcatcattgggaagaaaggggagtcggttaagaggatccgcgaggagagtggcgcgcggatcaacatctcggaggggaattgtccggagagaatca
  • Show more
Description: A cloning plasmid for the PCBP1 gene.

Anti-PCBP1 (1G2)
YF-MA10665 100 ug
EUR 363
Description: Mouse monoclonal to PCBP1

Anti-PCBP1 (1G2)
YF-MA20383 200 ul
EUR 363
Description: Mouse monoclonal to PCBP1

Anti-PCBP1 (aa223-234) antibody
STJ72417 100 µg
EUR 359

Anti-PCBP1 (aa234-247) antibody
STJ72418 100 µg
EUR 359

PCBP1 protein (His tag)
80R-3020 100 ug
EUR 327
Description: Purified recombinant PCBP1 protein (His tag)

PCBP1 ELISA KIT|Human
EF008783 96 Tests
EUR 689

Mouse PCBP1 ELISA Kit
ELI-45078m 96 Tests
EUR 865

Bovine PCBP1 ELISA kit
ELI-45881b 96 Tests
EUR 928

Mouse PCBP1 shRNA Plasmid
20-abx973588
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PCBP1 shRNA Plasmid
20-abx953387
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PCBP1 ELISA kit
ELI-37482h 96 Tests
EUR 824

PCBP1 Recombinant Protein (Human)
RP022660 100 ug Ask for price

PCBP1 Recombinant Protein (Mouse)
RP160349 100 ug Ask for price

Poly(RC) Binding Protein 1 (PCBP1) Antibody
20-abx126328
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 1 (PCBP1) Antibody
abx036852-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Poly (RC) Binding Protein 1 (PCBP1) Antibody
20-abx137477
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 1 (PCBP1) Antibody
abx030587-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 1 (PCBP1) Antibody
abx030587-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 1 (PCBP1) Antibody
abx431792-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Poly(RC) Binding Protein 1 (PCBP1) Antibody
abx431793-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Poly(RC) Binding Protein 1 (PCBP1) Antibody
20-abx306776
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PCBP1 ORF Vector (Human) (pORF)
ORF007554 1.0 ug DNA
EUR 95

Pcbp1 ORF Vector (Mouse) (pORF)
ORF053451 1.0 ug DNA
EUR 506

PCBP1 Western Blot kit (AWBK40630)
AWBK40630 10 reactions
EUR 647
Description:
  • Description of target:
  • Species reactivity:
  • Application:
  • Assay info:
  • Sensitivity:

Poly(RC) Binding Protein 1 (PCBP1) Antibody (HRP)
20-abx306777
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 1 (PCBP1) Antibody (FITC)
20-abx306778
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 1 (PCBP1) Antibody (Biotin)
20-abx306779
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pcbp1 sgRNA CRISPR Lentivector set (Mouse)
K4854101 3 x 1.0 ug
EUR 339

PCBP1 sgRNA CRISPR Lentivector set (Human)
K1601101 3 x 1.0 ug
EUR 339

PCBP1-AS1 ORF Vector (Human) (pORF)
ORF027451 1.0 ug DNA Ask for price

Pcbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4854102 1.0 ug DNA
EUR 154

Pcbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4854103 1.0 ug DNA
EUR 154

Pcbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4854104 1.0 ug DNA
EUR 154

PCBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1601102 1.0 ug DNA
EUR 154

PCBP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1601103 1.0 ug DNA
EUR 154

PCBP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1601104 1.0 ug DNA
EUR 154

PCBP1 Protein Vector (Mouse) (pPB-C-His)
PV213802 500 ng
EUR 329

PCBP1 Protein Vector (Mouse) (pPB-N-His)
PV213803 500 ng
EUR 329

PCBP1 Protein Vector (Mouse) (pPM-C-HA)
PV213804 500 ng
EUR 329

PCBP1 Protein Vector (Mouse) (pPM-C-His)
PV213805 500 ng
EUR 329

PCBP1 Protein Vector (Human) (pPB-C-His)
PV030213 500 ng
EUR 329

PCBP1 Protein Vector (Human) (pPB-N-His)
PV030214 500 ng
EUR 329

PCBP1 Protein Vector (Human) (pPM-C-HA)
PV030215 500 ng
EUR 329

PCBP1 Protein Vector (Human) (pPM-C-His)
PV030216 500 ng
EUR 329

Recombinant Poly/rC Binding Protein 1 (PCBP1)
4-RPE963Po01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: I3LEC2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.2kDa
  • Isoelectric Point: 7
Description: Recombinant Pig Poly/rC Binding Protein 1 expressed in: E.coli

Recombinant Human PCBP1 Protein, His, E.coli-1mg
QP12972-1mg 1mg
EUR 2757

Recombinant Human PCBP1 Protein, His, E.coli-20ug
QP12972-20ug 20ug
EUR 201

Recombinant Human PCBP1 Protein, His, E.coli-5ug
QP12972-5ug 5ug
EUR 155

Pcbp1 3'UTR Luciferase Stable Cell Line
TU115961 1.0 ml Ask for price

Pcbp1 3'UTR GFP Stable Cell Line
TU165961 1.0 ml Ask for price

Pcbp1 3'UTR Luciferase Stable Cell Line
TU215859 1.0 ml Ask for price

Pcbp1 3'UTR GFP Stable Cell Line
TU265859 1.0 ml Ask for price

PCBP1 3'UTR GFP Stable Cell Line
TU067464 1.0 ml
EUR 1394

PCBP1 3'UTR Luciferase Stable Cell Line
TU017464 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

 

Scroll to Top