PKN1 Rabbit Polyclonal Antibody

To Order:

PKN1 Polyclonal Antibody

ABP59926-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800

Human Protein Kinase N1 (PKN1) ELISA Kit

DLR-PKN1-Hu-48T 48T
EUR 479
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protein Kinase N1 (PKN1) ELISA Kit

DLR-PKN1-Hu-96T 96T
EUR 621
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protein Kinase N1 (PKN1) ELISA Kit

RD-PKN1-Hu-48Tests 48 Tests
EUR 478

Human Protein Kinase N1 (PKN1) ELISA Kit

RD-PKN1-Hu-96Tests 96 Tests
EUR 662

Human Protein Kinase N1 (PKN1) ELISA Kit

RDR-PKN1-Hu-48Tests 48 Tests
EUR 500

Human Protein Kinase N1 (PKN1) ELISA Kit

RDR-PKN1-Hu-96Tests 96 Tests
EUR 692

PKN1 Rabbit pAb

A0553-100ul 100 ul
EUR 308

PKN1 Rabbit pAb

A0553-200ul 200 ul
EUR 459

PKN1 Rabbit pAb

A0553-20ul 20 ul
EUR 183

PKN1 Rabbit pAb

A0553-50ul 50 ul
EUR 223

PKN1 antibody

70R-50256 100 ul
EUR 244
Description: Purified Polyclonal PKN1 antibody

PKN1 Antibody

ABD4790 100 ug
EUR 438

PKN1 Antibody

48392-100ul 100ul
EUR 333

PKN1 Antibody

48392-50ul 50ul
EUR 239

PKN1 Antibody

DF4790 200ul
EUR 304
Description: PKN1 Antibody detects endogenous levels of total PKN1.

PKN1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PKN1. Recognizes PKN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Rabbit PKN1 ELISA Kit

ERTP0125 96Tests
EUR 521

PKN1 Conjugated Antibody

C48392 100ul
EUR 397

PKN1/PRK1 Antibody

35295-100ul 100ul
EUR 252

PKN1/PRK1 Antibody

35295-50ul 50ul
EUR 187

Anti-PKN1 antibody

STJ110991 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-PKN1 antibody

STJ190147 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PKN1

Pkn1/ Rat Pkn1 ELISA Kit

ELI-37289r 96 Tests
EUR 886

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13997 50 ug
EUR 363
Description: Mouse polyclonal to PKN1


YF-PA13998 100 ug
EUR 403
Description: Rabbit polyclonal to PKN1


YF-PA27338 100 ul
EUR 403
Description: Rabbit polyclonal to PKN1

PKN1/PRK1 Conjugated Antibody

C35295 100ul
EUR 397

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with APC.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with Biotin.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), Cy3

  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with Cy3.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), FITC

  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with FITC.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), HRP

  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with HRP.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), PE

  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with PE.

Rabbit Protein Kinase N1 (PKN1) ELISA Kit

abx362392-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

PKN1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PKN1 Blocking Peptide

DF4790-BP 1mg
EUR 195

PKN1 cloning plasmid

CSB-CL623082HU-10ug 10ug
EUR 902
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2829
  • Sequence: atggccagcgacgccgtgcagagtgagcctcgcagctggtccctgctagagcagctgggcctggccggggcagacctggcggcccccggggtacagcagcagctggagctggagcgggagcggctgcggcgggaaatccgcaaggagctgaagctgaaggagggtgctgagaacc
  • Show more
Description: A cloning plasmid for the PKN1 gene.

Anti-PKN1 (1B10)

YF-MA14890 100 ug
EUR 363
Description: Mouse monoclonal to PKN1

Anti-PKN1 (1A4)

YF-MA14891 100 ug
EUR 363
Description: Mouse monoclonal to PKN1

Monoclonal PKN1 Antibody, Clone: EPR3238

AMM07214G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Rabbit and are from clone EPR3238. This antibody is applicable in WB, FC

Monoclonal PKN1 Antibody, Clone: 4H10B1

AMM03009G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Mouse and are from clone 4H10B1. This antibody is applicable in WB and IHC, FC, ICC, E

Protein Kinase N1 (PKN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Kinase N1 (PKN1) Antibody

  • EUR 300.00
  • EUR 133.00
  • EUR 746.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Kinase N1 (PKN1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Protein Kinase N1 (PKN1) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Antibody for Human PKN1 (pThr774)

SPC-1065D 0.1ml
EUR 354
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is unconjugated.

Antibody for Human PKN1 (pThr774)

SPC-1065D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 390.

Antibody for Human PKN1 (pThr774)

SPC-1065D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 488.

Antibody for Human PKN1 (pThr774)

SPC-1065D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 565.

Antibody for Human PKN1 (pThr774)

SPC-1065D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 594.

Antibody for Human PKN1 (pThr774)

SPC-1065D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 633.


Scroll to Top