RIPK2 (Phospho-Ser176) Antibody

To Order:

Phospho-RIPK2(Ser176) Antibody

AF0049 200ul
EUR 304
Description: Phospho-RIPK2(Ser176) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Sersine 176.

Phospho- RIPK2 (Ser176) Antibody

ABF0048 100 ug
EUR 438

Phospho- RIPK2 (Ser176) Antibody

ABF0049 100 ug
EUR 438

Phospho-RIPK2 (Ser176) Antibody

EUR 479

RIPK2 (Phospho-Ser176) Polyclonal Antibody

ABP60180-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein

RIPK2 (Phospho-Ser176) Polyclonal Antibody

ABP60180-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein

RIPK2 (Phospho-Ser176) Polyclonal Antibody

ABP60180-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein

Anti-Phospho-RIPK2 (Ser176) antibody

STJ99600 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-RIPK2 (Ser176).

RIPK2 antibody (Ser176)

70R-32731 100 ug
EUR 327
Description: Rabbit polyclonal RIPK2 antibody (Ser176)

Phospho-RIPK2(Ser176) Blocking Peptide

AF0049-BP 1mg
EUR 195

RIPK2 (Phospho-Ser176) Colorimetric Cell-Based ELISA Kit

EKC2582 100ul
EUR 572

Phospho-RIPK2 (Ser176) Colorimetric Cell-Based ELISA Kit (OKAG02134)

OKAG02134 2 x 96 Wells
EUR 740
Description: Description of target: ;Species reactivity: Human: S176, Mouse: S176;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: Phospho
Detection Method: Colorimetric 450 nm;Sensitivity:

Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody

abx333065-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

YB1 (Phospho-Ser176) Antibody

13181-100ul 100ul
EUR 252

YB1 (Phospho-Ser176) Antibody

13181-50ul 50ul
EUR 187

Phospho-YB1 (Ser176) Antibody

AF7332 200ul
EUR 376
Description: Phospho-YB1 (Ser176) Antibody detects endogenous levels of YB1 only when phosphorylated at Ser176.

Phospho- RIP2 (Ser176) Antibody

ABF3730 100 ug
EUR 438

YB1 (Phospho-Ser176) Conjugated Antibody

C13181 100ul
EUR 397

RIP2 (phospho Ser176) Polyclonal Antibody

ABP56874-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
  • Applications tips:
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176

RIP2 (phospho Ser176) Polyclonal Antibody

ABP56874-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
  • Applications tips:
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176

RIP2 (phospho Ser176) Polyclonal Antibody

ABP56874-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
  • Applications tips:
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176

RIP2 (phospho Ser176) Polyclonal Antibody

ES7873-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

RIP2 (phospho Ser176) Polyclonal Antibody

ES7873-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

RIPK2 (Phospho-Ser531) Antibody

12981-100ul 100ul
EUR 252

RIPK2 (Phospho-Ser531) Antibody

12981-50ul 50ul
EUR 187

RIPK2 (Phospho-Tyr381) Antibody

12982-100ul 100ul
EUR 252

RIPK2 (Phospho-Tyr381) Antibody

12982-50ul 50ul
EUR 187

Phospho-RIPK2 (S176) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RIPK2 (S176). Recognizes Phospho-RIPK2 (S176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

Phospho-RIPK2 (Ser531) Antibody

AF7118 200ul
EUR 376
Description: Phospho-RIPK2 (Ser531) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Ser531.

IKK alpha/beta antibody (Phospho-Ser176)

70R-11103 50 ug
EUR 327
Description: Rabbit polyclonal IKK alpha/beta antibody for detection of the Phospho-Ser176 form of the IKK alpha/beta peptide.

Phospho-CHUK/IKBKB (Ser176/177) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-CHUK/IKBKB (Ser176/177) Antibody

CSB-PA983649-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

IKK?/? (phospho Ser176/177) Polyclonal Antibody

ES4646-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IKK?/? (phospho Ser176/177) Polyclonal Antibody

ES4646-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Phospho-YB1 (Ser176) Blocking Peptide

AF7332-BP 1mg
EUR 195

RIPK2 (Phospho-Tyr381) Conjugated Antibody

C12982 100ul
EUR 397

IKK- alpha/ beta (Phospho-Ser176/177) Antibody

11931-100ul 100ul
EUR 252

IKK- alpha/ beta (Phospho-Ser176/177) Antibody

11931-50ul 50ul
EUR 187

IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody

ABP53647-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
  • Applications tips:
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177

IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody

ABP53647-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
  • Applications tips:
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177

IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody

ABP53647-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
  • Applications tips:
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177

anti-IKK α/β (Phospho-Ser176)

LF-PA20648 100 ul
EUR 354
Description: Rabbit polyclonal to IKK α/β (Phospho-Ser176)

RIPK2 (Phospho-Ser531) Polyclonal Conjugated Antibody

C12981 100ul
EUR 397

Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Antibody

AF3014 200ul
EUR 304
Description: Phospho-IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody detects endogenous levels of IKK- alpha /IKK- beta only when phosphorylated at Serine 177.

Phospho- IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody

ABF3014 100 ug
EUR 438

Phospho-RIPK2 (Ser531) Blocking Peptide

AF7118-BP 1mg
EUR 195

RIPK2 antibody

70R-10459 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RIPK2 antibody

RIPK2 antibody

70R-19904 50 ul
EUR 435
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 Antibody

32675-100ul 100ul
EUR 252

RIPK2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody

DF2641 200ul
EUR 304
Description: RIPK2 antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody

DF6967 200ul
EUR 304
Description: RIPK2 Antibody detects endogenous levels of total RIPK2.

RIPK2 antibody

70R-32732 100 ug
EUR 327
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

RIPK2 Antibody

AF7618 200ul
EUR 376
Description: RIPK2 Antibody detects endogenous levels of RIPK2.

RIPK2 Antibody

ABD2641 100 ug
EUR 438

RIPK2 Antibody

ABD6967 100 ug
EUR 438

IKK- alpha/ beta (Phospho-Ser176/177) Polyclonal Conjugated Antibody

C11931 100ul
EUR 397

RIPK2 (pS176) Antibody

abx011477-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RIPK2 (pS176) Antibody

abx011478-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RIPK2 Conjugated Antibody

C32675 100ul
EUR 397

RIPK2 Polyclonal Antibody

A54388 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- RIPK2 antibody

FNab07314 100µg
EUR 548.75
  • Immunogen: receptor-interacting serine-threonine kinase 2
  • Uniprot ID: O43353
  • Gene ID: 8767
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK2

Anti-RIPK2 antibody

PAab07314 100 ug
EUR 386

Anti-RIPK2 antibody

STJ25358 100 µl
EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 antibody

STJ115343 100 µl
EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 Antibody

STJ502801 100 µg
EUR 476

IKK alpha/beta antibody (Ser176)

70R-31308 100 ug
EUR 327
Description: Rabbit polyclonal IKK alpha/beta antibody (Ser176)

IKK a/b antibody (Ser176)

70R-37438 100 ug
EUR 349
Description: Rabbit Polyclonal IKK a/b antibody (Ser176)

Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Blocking Peptide

AF3014-BP 1mg
EUR 195

RIPK2 protein

30R-2861 5 ug
EUR 503
Description: Purified recombinant Human RIPK2 protein

RIPK2, Active

EUR 370


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RIP2/RIPK2 Antibody

PA1861 100ug/vial
EUR 294

Anti-RIPK2 Antibody (Biotin)

STJ502802 100 µg
EUR 586

Anti-RIPK2 Antibody (FITC)

STJ502803 100 µg
EUR 586

IKK-alpha (Phospho-Ser176) /IKK-beta (Phospho-Ser177) Colorimetric Cell-Based ELISA Kit

EKC2043 100ul
EUR 572

RIPK2 Rabbit pAb

A13381-100ul 100 ul
EUR 308

RIPK2 Rabbit pAb

A13381-200ul 200 ul
EUR 459

RIPK2 Rabbit pAb

A13381-20ul 20 ul
EUR 183

RIPK2 Rabbit pAb

A13381-50ul 50 ul
EUR 223

RIPK2 Blocking Peptide

33R-5381 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK2 antibody, catalog no. 70R-10459

RIPK2 Blocking Peptide

DF2641-BP 1mg
EUR 195

RIPK2 Blocking Peptide

DF6967-BP 1mg
EUR 195

RIPK2 cloning plasmid

CSB-CL019736HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1623
  • Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
  • Show more
Description: A cloning plasmid for the RIPK2 gene.

RIPK2 Blocking Peptide

AF7618-BP 1mg
EUR 195

RIPK2 Rabbit pAb

A2498-100ul 100 ul
EUR 308

RIPK2 Rabbit pAb

A2498-200ul 200 ul
EUR 459

RIPK2 Rabbit pAb

A2498-20ul 20 ul
EUR 183

RIPK2 Rabbit pAb

A2498-50ul 50 ul
EUR 223

Polyclonal RIPK2 Antibody (C-term)

AMR09745G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal RIPK2 Antibody (N-term)

AMR09748G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (N-term). This antibody is tested and proven to work in the following applications:

RIPK2 Polyclonal Antibody, Biotin Conjugated

A54385 100 µg
EUR 570.55
Description: The best epigenetics products

RIPK2 Polyclonal Antibody, FITC Conjugated

A54386 100 µg
EUR 570.55
Description: kits suitable for this type of research

RIPK2 Polyclonal Antibody, HRP Conjugated

A54387 100 µg
EUR 570.55
Description: fast delivery possible


ELA-E1786h 96 Tests
EUR 824


EHR0362 96Tests
EUR 521

Bovine RIPK2 ELISA Kit

EBR0362 96Tests
EUR 521

Anserini RIPK2 ELISA Kit

EAR0362 96Tests
EUR 521

Chicken RIPK2 ELISA Kit

ECKR0362 96Tests
EUR 521

Canine RIPK2 ELISA Kit

ECR0362 96Tests
EUR 521


EGTR0362 96Tests
EUR 521


ELI-05786b 96 Tests
EUR 928


ELI-05787h 96 Tests
EUR 824

Mouse Ripk2 ELISA KIT

ELI-05788m 96 Tests
EUR 865


EF007144 96 Tests
EUR 689


abx595529-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human RIPK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RIPK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine RIPK2 ELISA Kit

EPR0362 96Tests
EUR 521


ESR0362 96Tests
EUR 521


ERR0362 96Tests
EUR 521

Rabbit RIPK2 ELISA Kit

ERTR0362 96Tests
EUR 521

Monkey RIPK2 ELISA Kit

EMKR0362 96Tests
EUR 521


EMR0362 96Tests
EUR 521

Phospho-IKK- Alpha (Ser176) /IKK- Beta (Ser177) Colorimetric Cell-Based ELISA Kit (OKAG01568)

OKAG01568 2 x 96 Wells
EUR 740
Description: Description of target: ;Species reactivity: Human: S176/S177, Mouse: S176/S177, Rat: S176/S177;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: Phospho
Detection Method: Colorimetric 450 nm;Sensitivity:

Monoclonal RIPK2 Antibody (monoclonal) (M02), Clone: 6F7

AMR09746G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RIPK2 (monoclonal) (M02). The antibodies are raised in Mouse and are from clone 6F7. This antibody is applicable in WB and IHC, E

Monoclonal RIPK2 Antibody (monoclonal) (M05), Clone: 7F5

AMR09747G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RIPK2 (monoclonal) (M05). The antibodies are raised in Mouse and are from clone 7F5. This antibody is applicable in WB and IHC, E

Guinea Pig RIPK2 ELISA Kit

EGR0362 96Tests
EUR 521

Ripk2 ORF Vector (Rat) (pORF)

ORF075393 1.0 ug DNA
EUR 506

h RIPK2 inducible lentiviral particles

LVP222 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, RIPK2, is fully sequence verified and matched to NCBI accession ID: NM_003821

RIPK2 ORF Vector (Human) (pORF)

ORF008828 1.0 ug DNA
EUR 95

Ripk2 ORF Vector (Mouse) (pORF)

ORF056095 1.0 ug DNA
EUR 506

RIPK2 ELISA Kit (Mouse) (OKEH05329)

OKEH05329 96 Wells
EUR 662
Description: Description of target: Serine/threonine/tyrosine kinase that plays an essential role in modulation of innate and adaptive immune responses. Upon stimulation by bacterial peptidoglycans, NOD1 and NOD2 are activated, oligomerize and recruit RIPK2 through CARD-CARD domains. Once recruited, autophosphorylates and undergoes 'Lys-63'-linked polyubiquitination by E3 ubiquitin ligases XIAP, BIRC2 and BIRC3. The polyubiquitinated protein mediates the recruitment of MAP3K7/TAK1 to IKBKG/NEMO and induces 'Lys-63'-linked polyubiquitination of IKBKG/NEMO and subsequent activation of IKBKB/IKKB. In turn, NF-kappa-B is release from NF-kappa-B inhibitors and translocates into the nucleus where it activates the transcription of hundreds of genes involved in immune response, growth control, or protection against apoptosis. Plays also a role during engagement of the T-cell receptor (TCR) in promoting BCL10 phosphorylation and subsequent NF-kappa-B activation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

RIPK2 ELISA Kit (Human) (OKEH05330)

OKEH05330 96 Wells
EUR 662
Description: Description of target: Serine/threonine/tyrosine kinase that plays an essential role in modulation of innate and adaptive immune responses. Upon stimulation by bacterial peptidoglycans, NOD1 and NOD2 are activated, oligomerize and recruit RIPK2 through CARD-CARD domains. Contributes to the tyrosine phosphorylation of the guanine exchange factor ARHGEF2 through Src tyrosine kinase leading to NF-kappaB activation by NOD2. Once recruited, RIPK2 autophosphorylates and undergoes 'Lys-63'-linked polyubiquitination by E3 ubiquitin ligases XIAP, BIRC2 and BIRC3. The polyubiquitinated protein mediates the recruitment of MAP3K7/TAK1 to IKBKG/NEMO and induces 'Lys-63'-linked polyubiquitination of IKBKG/NEMO and subsequent activation of IKBKB/IKKB. In turn, NF-kappa-B is released from NF-kappa-B inhibitors and translocates into the nucleus where it activates the transcription of hundreds of genes involved in immune response, growth control, or protection against apoptosis. Plays also a role during engagement of the T-cell receptor (TCR) in promoting BCL10 phosphorylation and subsequent NF-kappa-B activation.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL


Scroll to Top