SOX7 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

SOX7 Rabbit pAb

A9587-100ul 100 ul
EUR 308

SOX7 Rabbit pAb

A9587-200ul 200 ul
EUR 459

SOX7 Rabbit pAb

A9587-20ul 20 ul Ask for price

SOX7 Rabbit pAb

A9587-50ul 50 ul Ask for price

SOX7 Rabbit pAb

A14941-100ul 100 ul
EUR 308

SOX7 Rabbit pAb

A14941-200ul 200 ul
EUR 459

SOX7 Rabbit pAb

A14941-20ul 20 ul
EUR 183

SOX7 Rabbit pAb

A14941-50ul 50 ul
EUR 223

Polyclonal SOX7 Antibody (Center)

APR04774G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX7 (Center). This antibody is tested and proven to work in the following applications:

SOX7 antibody

20R-1133 100 ug
EUR 377
Description: Rabbit polyclonal SOX7 antibody

SOX7 Antibody

31129-100ul 100ul
EUR 252

SOX7 Antibody

31129-50ul 50ul
EUR 187

SOX7 Antibody

1-CSB-PA693928
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX7. Recognizes SOX7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:5000

SOX7 Antibody

DF8865 200ul
EUR 304
Description: SOX7 Antibody detects endogenous levels of total SOX7.

SOX7 Antibody

1-CSB-PA556897
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX7. Recognizes SOX7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

SOX7 antibody

70R-8384 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SOX7 antibody

SOX7 antibody

70R-8385 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SOX7 antibody

SOX7 Antibody

ABD8865 100 ug
EUR 438

Polyclonal SOX7 Antibody (C-term)

APR04757G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX7 (C-term). This antibody is tested and proven to work in the following applications:

SOX7

MO15050 50 ug
EUR 252

Polyclonal SOX7 antibody - N-terminal region

APR00697G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX7 - N-terminal region. This antibody is tested and proven to work in the following applications:

SOX7 Conjugated Antibody

C31129 100ul
EUR 397

anti- SOX7 antibody

FNab08129 100µg
EUR 548.75
  • Immunogen: SRY(sex determining region Y)-box 7
  • Uniprot ID: Q9BT81
  • Gene ID: 83595
  • Research Area: Epigenetics, Stem Cells, Metabolism
Description: Antibody raised against SOX7

Anti-SOX7 Antibody

PA2285 100ug/vial
EUR 294

Anti-SOX7 antibody

PAab08129 100 ug
EUR 386

Anti-SOX7 antibody

STJ111756 100 µl
EUR 277
Description: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway.

Anti-SOX7 antibody

STJ117140 100 µl
EUR 277
Description: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway.

Anti-SOX7 antibody

STJ190248 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SOX7

SOX7 siRNA

20-abx934739
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SOX7 siRNA

20-abx934740
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SOX7 Blocking Peptide

33R-2017 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOX7 antibody, catalog no. 70R-8384

SOX7 Blocking Peptide

33R-4965 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOX7 antibody, catalog no. 20R-1133

SOX7 Blocking Peptide

33R-5140 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOX7 antibody, catalog no. 70R-8385

SOX7 Blocking Peptide

DF8865-BP 1mg
EUR 195

SOX7 cloning plasmid

CSB-CL866278HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: atggcttcgctgctgggagcctacccttggcccgagggtctcgagtgcccggccctggacgccgagctgtcggatggacaatcgccgccggccgtcccccggcccccgggggacaagggctccgagagccgtatccggcggcccatgaacgccttcatggtttgggccaaggacg
  • Show more
Description: A cloning plasmid for the SOX7 gene.

SOX7 ELISA KIT|Human

EF003145 96 Tests
EUR 689

Mouse SOX7 shRNA Plasmid

20-abx972836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SOX7 shRNA Plasmid

20-abx963136
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SOX7 Recombinant Protein (Rat)

RP230540 100 ug Ask for price

pcDNA3.1(+)-Myc-SOX7 Plasmid

PVTB00171-2a 2 ug
EUR 356

SOX7 Recombinant Protein (Human)

RP029731 100 ug Ask for price

SOX7 Recombinant Protein (Mouse)

RP174617 100 ug Ask for price

Sox7 ORF Vector (Rat) (pORF)

ORF076848 1.0 ug DNA
EUR 506

SOX7 ORF Vector (Human) (pORF)

ORF009911 1.0 ug DNA
EUR 95

Sox7 ORF Vector (Mouse) (pORF)

ORF058207 1.0 ug DNA
EUR 506

Sox7 sgRNA CRISPR Lentivector set (Rat)

K6531701 3 x 1.0 ug
EUR 339

Sox7 sgRNA CRISPR Lentivector set (Mouse)

K3424101 3 x 1.0 ug
EUR 339

SOX7 sgRNA CRISPR Lentivector set (Human)

K2260701 3 x 1.0 ug
EUR 339

Sex Determining Region Y Box Protein 7 (SOX7) Antibody

20-abx212532
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sex Determining Region Y Box Protein 7 (SOX7) Antibody

20-abx213498
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sex Determining Region Y Box Protein 7 (SOX7) Antibody

20-abx123739
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Sex Determining Region Y Box Protein 7 (SOX7) Antibody

abx238129-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sox7 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6531702 1.0 ug DNA
EUR 154

Sox7 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6531703 1.0 ug DNA
EUR 154

Sox7 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6531704 1.0 ug DNA
EUR 154

Sox7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3424102 1.0 ug DNA
EUR 154

Sox7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3424103 1.0 ug DNA
EUR 154

Sox7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3424104 1.0 ug DNA
EUR 154

SOX7 sgRNA CRISPR Lentivector (Human) (Target 1)

K2260702 1.0 ug DNA
EUR 154

SOX7 sgRNA CRISPR Lentivector (Human) (Target 2)

K2260703 1.0 ug DNA
EUR 154

SOX7 sgRNA CRISPR Lentivector (Human) (Target 3)

K2260704 1.0 ug DNA
EUR 154

SOX7 Protein Vector (Rat) (pPB-C-His)

PV307390 500 ng
EUR 603

SOX7 Protein Vector (Rat) (pPB-N-His)

PV307391 500 ng
EUR 603

SOX7 Protein Vector (Rat) (pPM-C-HA)

PV307392 500 ng
EUR 603

SOX7 Protein Vector (Rat) (pPM-C-His)

PV307393 500 ng
EUR 603

SOX7 Protein Vector (Human) (pPB-C-His)

PV039641 500 ng
EUR 329

SOX7 Protein Vector (Human) (pPB-N-His)

PV039642 500 ng
EUR 329

SOX7 Protein Vector (Human) (pPM-C-HA)

PV039643 500 ng
EUR 329

SOX7 Protein Vector (Human) (pPM-C-His)

PV039644 500 ng
EUR 329

SOX7 Protein Vector (Mouse) (pPB-C-His)

PV232826 500 ng
EUR 603

SOX7 Protein Vector (Mouse) (pPB-N-His)

PV232827 500 ng
EUR 603

SOX7 Protein Vector (Mouse) (pPM-C-HA)

PV232828 500 ng
EUR 603

SOX7 Protein Vector (Mouse) (pPM-C-His)

PV232829 500 ng
EUR 603

Sox7 3'UTR Luciferase Stable Cell Line

TU119493 1.0 ml Ask for price

Sox7 3'UTR GFP Stable Cell Line

TU169493 1.0 ml Ask for price

Sox7 3'UTR Luciferase Stable Cell Line

TU220995 1.0 ml Ask for price

Sox7 3'UTR GFP Stable Cell Line

TU270995 1.0 ml Ask for price

SOX7 3'UTR GFP Stable Cell Line

TU074339 1.0 ml
EUR 1521

SOX7 3'UTR Luciferase Stable Cell Line

TU024339 1.0 ml
EUR 1521

Mouse Transcription factor SOX- 7, Sox7 ELISA KIT

ELI-29104m 96 Tests
EUR 865

Human Transcription factor SOX- 7, SOX7 ELISA KIT

ELI-41403h 96 Tests
EUR 824

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

 

Scroll to Top