USF1 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

USF1 Polyclonal Antibody

ABP60862-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of USF1 from Human, Mouse. This USF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170

USF1 Polyclonal Antibody

ABP60862-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of USF1 from Human, Mouse. This USF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170

USF1 Polyclonal Antibody

A54724 100 µg
EUR 570.55
Description: Ask the seller for details

USF1 Rabbit pAb

A13560-100ul 100 ul
EUR 308

USF1 Rabbit pAb

A13560-200ul 200 ul
EUR 459

USF1 Rabbit pAb

A13560-20ul 20 ul
EUR 183

USF1 Rabbit pAb

A13560-50ul 50 ul
EUR 223

USF1 Antibody

ABD6592 100 ug
EUR 438

USF1 Antibody

42816-100ul 100ul
EUR 252

USF1 Antibody

32414-100ul 100ul
EUR 252

USF1 Antibody

DF6592 200ul
EUR 304
Description: USF1 Antibody detects endogenous levels of total USF1.

USF1 Antibody

1-CSB-PA938350
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

USF1 Antibody

1-CSB-PA980290
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

USF1 Antibody

1-CSB-PA025681HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

USF1 Antibody

CSB-PA025681KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

USF1 Antibody

CSB-PA025681KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

USF1 Polyclonal Antibody, Biotin Conjugated

A54721 100 µg
EUR 570.55
Description: reagents widely cited

USF1 Polyclonal Antibody, FITC Conjugated

A54722 100 µg
EUR 570.55
Description: Ask the seller for details

USF1 Polyclonal Antibody, HRP Conjugated

A54723 100 µg
EUR 570.55
Description: The best epigenetics products

USF1 (Phospho-Thr153) Polyclonal Conjugated Antibody

C12651 100ul
EUR 397

USF1 Conjugated Antibody

C32414 100ul
EUR 397

anti- USF1 antibody

FNab09297 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: upstream transcription factor 1
  • Uniprot ID: P22415
  • Gene ID: 7391
  • Research Area: Metabolism
Description: Antibody raised against USF1

USF1 (pT153) Antibody

abx219267-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-USF1 antibody

PAab09297 100 ug
EUR 412

Anti-USF1 antibody

STJ26051 100 µl
EUR 277
Description: This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. This gene has been linked to familial combined hyperlipidemia (FCHL). Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been defined on chromosome 21.

Anti-USF1 antibody

STJ115521 100 µl
EUR 277
Description: This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. This gene has been linked to familial combined hyperlipidemia (FCHL). Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been defined on chromosome 21.

Anti-USF1 antibody

STJ190144 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to USF1

USF1 siRNA

20-abx939129
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

USF1 siRNA

20-abx939130
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-USF1

YF-PA15249 100 ug
EUR 403
Description: Rabbit polyclonal to USF1

anti-USF1

YF-PA27396 50 ug
EUR 363
Description: Mouse polyclonal to USF1

anti-USF1

YF-PA24948 50 ul
EUR 334
Description: Mouse polyclonal to USF1

Phospho-USF1 (Thr153) Antibody

AF8331 200ul
EUR 376
Description: USF1 (Phospho-Thr153) Antibody detects endogenous levels of USF1 only when phosphorylated at Thr153.

USF1 (Phospho- Thr153) Antibody

ABF8331 100 ug
EUR 438

USF1 (Phospho-Thr153) Antibody

12651-100ul 100ul
EUR 252

USF1 (Phospho-Thr153) Antibody

12651-50ul 50ul
EUR 187

USF1 Antibody, HRP conjugated

1-CSB-PA025681HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

USF1 Antibody, FITC conjugated

1-CSB-PA025681HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

USF1 Antibody, Biotin conjugated

1-CSB-PA025681HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rabbit Anti-Human upstream transcription factor 1 (USF1) (USF1- acetyl) IgG (aff pure)

AB-23272-A 100ug
EUR 482

USF1 cloning plasmid

CSB-CL025681HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: atgaaggggcagcagaaaacagctgaaacggaagaggggacagtgcagattcaggaaggtgcagtggctactggggaagacccaaccagtgtggctattgccagcatccagtcagctgccaccttccctgaccccaacgtcaagtacgtcttccgaactgagaatgggggccaggt
  • Show more
Description: A cloning plasmid for the USF1 gene.

USF1 Blocking Peptide

DF6592-BP 1mg
EUR 195

pcDNA3.1-USF1 Plasmid

PVTB00093-2a 2 ug
EUR 356

pOTB7-USF1 Plasmid

PVTB00093S 2 ug
EUR 356

Anti-USF1 (3F6)

YF-MA16035 100 ug
EUR 363
Description: Mouse monoclonal to USF1

Anti-USF1 (2A7)

YF-MA16036 100 ug
EUR 363
Description: Mouse monoclonal to USF1

Rabbit Upstream stimulatory factor 1, USF1 ELISA KIT

ELI-16725Ra 96 Tests
EUR 928

Human upstream transcription factor 1 (USF1) control (USF1- acetyl) peptide

AB-23272-P 100ug
EUR 164

Monoclonal USF1 Antibody (Center), Clone: 1264CT170.274.14

APR10696G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human USF1 (Center). The antibodies are raised in Mouse and are from clone 1264CT170.274.14. This antibody is applicable in WB, E

Upstream Stimulatory Factor 1 (USF1) Antibody

abx117152-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

20-abx110338
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

20-abx001455
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Upstream Stimulatory Factor 1 (USF1) Antibody

20-abx142299
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

 

Scroll to Top