APLF Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

APLF Polyclonal Antibody
ABP57789-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human APLF protein
  • Applications tips:
Description: A polyclonal antibody for detection of APLF from Human, Mouse, Rat. This APLF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APLF protein

APLF Polyclonal Antibody
ABP57789-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human APLF protein
  • Applications tips:
Description: A polyclonal antibody for detection of APLF from Human, Mouse, Rat. This APLF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APLF protein

APLF Polyclonal Antibody
ABP54105-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human APLF around the non-phosphorylation site of S116
  • Applications tips:
Description: A polyclonal antibody for detection of APLF from Human, Mouse. This APLF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human APLF around the non-phosphorylation site of S116

APLF Polyclonal Antibody
ABP54105-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human APLF around the non-phosphorylation site of S116
  • Applications tips:
Description: A polyclonal antibody for detection of APLF from Human, Mouse. This APLF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human APLF around the non-phosphorylation site of S116

APLF Polyclonal Antibody
ABP54105-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human APLF around the non-phosphorylation site of S116
  • Applications tips:
Description: A polyclonal antibody for detection of APLF from Human, Mouse. This APLF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human APLF around the non-phosphorylation site of S116

APLF Antibody
AF0108 200ul
EUR 304
Description: APLF antibody detects endogenous levels of total APLF.

APLF Antibody
ABF0108 100 ug
EUR 438

APLF antibody
70R-34460 100 ug
EUR 327
Description: Rabbit polyclonal APLF antibody

APLF Antibody
36118-100ul 100ul
EUR 252

APLF antibody
70R-15766 50 ul
EUR 435
Description: Rabbit polyclonal APLF antibody

APLF Antibody
1-CSB-PA001908GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against APLF. Recognizes APLF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

APLF Antibody
1-CSB-PA008030
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against APLF. Recognizes APLF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

APLF Antibody
1-CSB-PA825036
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against APLF. Recognizes APLF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

APLF Antibody
1-CSB-PA784037
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against APLF. Recognizes APLF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

APLF (phospho Ser116) Polyclonal Antibody
ES5103-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against APLF (phospho Ser116) from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

APLF (phospho Ser116) Polyclonal Antibody
ES5103-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against APLF (phospho Ser116) from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

APLF (phospho Ser116) Polyclonal Antibody
ABP54104-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human APLF around the phosphorylation site of S116
  • Applications tips:
Description: A polyclonal antibody for detection of APLF phospho Ser116) from Human, Mouse. This APLF phospho Ser116) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human APLF around the phosphorylation site of S116

APLF (phospho Ser116) Polyclonal Antibody
ABP54104-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human APLF around the phosphorylation site of S116
  • Applications tips:
Description: A polyclonal antibody for detection of APLF phospho Ser116) from Human, Mouse. This APLF phospho Ser116) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human APLF around the phosphorylation site of S116

APLF (phospho Ser116) Polyclonal Antibody
ABP54104-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human APLF around the phosphorylation site of S116
  • Applications tips:
Description: A polyclonal antibody for detection of APLF phospho Ser116) from Human, Mouse. This APLF phospho Ser116) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human APLF around the phosphorylation site of S116

APLF (Phospho-Ser116) Polyclonal Conjugated Antibody
C12573 100ul
EUR 397

anti- APLF antibody
FNab00484 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: aprataxin and PNKP like factor
  • Uniprot ID: Q8IW19
  • Gene ID: 200558
  • Research Area: Metabolism
Description: Antibody raised against APLF

APLF (pS116) Antibody
abx148234-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-APLF Antibody
A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-APLF antibody
PAab00484 100 ug
EUR 355

Anti-APLF antibody
STJ91631 200 µl
EUR 197
Description: Rabbit polyclonal to APLF.

Anti-APLF antibody
STJ99628 200 µl
EUR 197
Description: Rabbit polyclonal to APLF.

APLF siRNA
20-abx907796
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APLF siRNA
20-abx907797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-APLF (Ser116) Antibody
AF8241 200ul
EUR 376
Description: APLF (Phospho-Ser116) Antibody detects endogenous levels of APLF only when phosphorylated at Ser116.

APLF (Phospho- Ser116) Antibody
ABF8241 100 ug
EUR 438

APLF (Phospho-Ser116) Antibody
12573-100ul 100ul
EUR 252

APLF (Phospho-Ser116) Antibody
12573-50ul 50ul
EUR 187

APLF (Ab-116) Antibody
33273-100ul 100ul
EUR 252

APLF (Ab-116) Antibody
33273-50ul 50ul
EUR 187

Phospho-APLF (S116) Antibody
1-CSB-PA008028
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-APLF (S116). Recognizes Phospho-APLF (S116) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

APLF (Ab-116) Antibody
CSB-PA109959-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against APLF (Ab-116). Recognizes APLF (Ab-116) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

APLF (Ab-116) Antibody
CSB-PA109959-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against APLF (Ab-116). Recognizes APLF (Ab-116) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

APLF Blocking Peptide
AF0108-BP 1mg
EUR 195

APLF cloning plasmid
CSB-CL814212HU-10ug 10ug
EUR 539
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1536
  • Sequence: atgtccgggggcttcgagctgcagccgcgggacggcggtccccgggtggccctggcgcccggggagacggtgatcggccgcgggccgctgctgggaataacagacaagagagtatccagaagacatgccattcttgaggtggcaggtggtcagctgcgaatcaaaccgatacaca
  • Show more
Description: A cloning plasmid for the APLF gene.

APLF (Ab-116) Conjugated Antibody
C33273 100ul
EUR 397

Anti-APLF (Ab-116) Antibody
A06828 100ul
EUR 397
Description: Rabbit Polyclonal APLF (Ab-116) Antibody. Validated in IHC, WB and tested in Human.

Anti-Phospho-APLF (S116) antibody
STJ91238 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-APLF (S116).

Mouse APLF shRNA Plasmid
20-abx977670
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

APLF ELISA KIT|Human
EF007822 96 Tests
EUR 689

Human APLF shRNA Plasmid
20-abx966254
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

APLF Recombinant Protein (Human)
RP001531 100 ug Ask for price

pCMV-SPORT6-APLF Plasmid
PVT16788 2 ug
EUR 325

APLF Recombinant Protein (Rat)
RP190514 100 ug Ask for price

APLF Recombinant Protein (Mouse)
RP116390 100 ug Ask for price

APLF Recombinant Protein (Mouse)
RP116393 100 ug Ask for price

Rabbit Apaxin and PNK-like factor(APLF) ELISA kit
E04A1591-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Apaxin and PNK-like factor(APLF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apaxin and PNK-like factor(APLF) ELISA kit
E04A1591-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Apaxin and PNK-like factor(APLF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apaxin and PNK-like factor(APLF) ELISA kit
E04A1591-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Apaxin and PNK-like factor(APLF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx111036
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx012964
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx325901
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx339818
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
abx331532-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
abx230484-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx210495
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospho-APLF (Ser116) Blocking Peptide
AF8241-BP 1mg
EUR 195

APLF ORF Vector (Human) (pORF)
ORF000511 1.0 ug DNA
EUR 95

Aplf ORF Vector (Mouse) (pORF)
ORF038798 1.0 ug DNA
EUR 506

Aplf ORF Vector (Mouse) (pORF)
ORF038799 1.0 ug DNA
EUR 506

Aplf ORF Vector (Rat) (pORF)
ORF063506 1.0 ug DNA
EUR 506

APLF ELISA Kit (Human) (OKEH08577)
OKEH08577 96 Wells
EUR 896
Description: Description of target: C2ORF13 is a component of the cellular response to chromosomal DNA single- and double-strand breaks (Iles et al., 2007 [PubMed 17353262]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086ng/mL

APLF sgRNA CRISPR Lentivector set (Human)
K0104201 3 x 1.0 ug
EUR 339

Aplf sgRNA CRISPR Lentivector set (Rat)
K6370501 3 x 1.0 ug
EUR 339

Aplf sgRNA CRISPR Lentivector set (Mouse)
K3249501 3 x 1.0 ug
EUR 339

APLF sgRNA CRISPR Lentivector (Human) (Target 1)
K0104202 1.0 ug DNA
EUR 154

APLF sgRNA CRISPR Lentivector (Human) (Target 2)
K0104203 1.0 ug DNA
EUR 154

APLF sgRNA CRISPR Lentivector (Human) (Target 3)
K0104204 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Rat) (Target 1)
K6370502 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Rat) (Target 2)
K6370503 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Rat) (Target 3)
K6370504 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3249502 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3249503 1.0 ug DNA
EUR 154

Aplf sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3249504 1.0 ug DNA
EUR 154

APLF Protein Vector (Human) (pPB-C-His)
PV002041 500 ng
EUR 329

APLF Protein Vector (Human) (pPB-N-His)
PV002042 500 ng
EUR 329

APLF Protein Vector (Human) (pPM-C-HA)
PV002043 500 ng
EUR 329

APLF Protein Vector (Human) (pPM-C-His)
PV002044 500 ng
EUR 329

APLF Protein Vector (Mouse) (pPB-C-His)
PV155190 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPB-N-His)
PV155191 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPM-C-HA)
PV155192 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPM-C-His)
PV155193 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPB-C-His)
PV155194 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPB-N-His)
PV155195 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPM-C-HA)
PV155196 500 ng
EUR 603

APLF Protein Vector (Mouse) (pPM-C-His)
PV155197 500 ng
EUR 603

APLF Protein Vector (Human) (pPB-His-MBP)
PV322758 500 ng
EUR 329

APLF Protein Vector (Human) (pPB-His-GST)
PV322759 500 ng
EUR 329

APLF Protein Vector (Rat) (pPB-C-His)
PV254022 500 ng
EUR 603

APLF Protein Vector (Rat) (pPB-N-His)
PV254023 500 ng
EUR 603

APLF Protein Vector (Rat) (pPM-C-HA)
PV254024 500 ng
EUR 603

APLF Protein Vector (Rat) (pPM-C-His)
PV254025 500 ng
EUR 603

Aplf 3'UTR Luciferase Stable Cell Line
TU200751 1.0 ml Ask for price

Aplf 3'UTR GFP Stable Cell Line
TU151946 1.0 ml Ask for price

APLF 3'UTR Luciferase Stable Cell Line
TU000947 1.0 ml
EUR 1521

Aplf 3'UTR Luciferase Stable Cell Line
TU101946 1.0 ml Ask for price

APLF 3'UTR GFP Stable Cell Line
TU050947 1.0 ml
EUR 1521

Aplf 3'UTR GFP Stable Cell Line
TU250751 1.0 ml Ask for price

Aprataxin And PNKP Like Factor Phospho-Ser116 (APLF pS116) Antibody
20-abx325264
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

 

Scroll to Top