CD300e Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

CD300e Polyclonal Antibody

ABP58061-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD300e protein at amino acid sequence of 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of CD300e from Human. This CD300e antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD300e protein at amino acid sequence of 31-80

CD300e Polyclonal Antibody

ES8686-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD300e from Human. This antibody is tested and validated for IHC, WB, ELISA

CD300e Polyclonal Antibody

ES8686-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD300e from Human. This antibody is tested and validated for IHC, WB, ELISA

CD300E Antibody

46436-100ul 100ul
EUR 252

CD300E Antibody

1-CSB-PA405404
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CD300E. Recognizes CD300E from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

Anti-CD300e antibody

STJ98749 200 µl
EUR 197
Description: Rabbit polyclonal to CD300e.

CD300E siRNA

20-abx910996
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD300E siRNA

20-abx910997
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CD300e

YF-PA23001 50 ul
EUR 363
Description: Mouse polyclonal to CD300e

Anti-CD300e/Lmir6 Antibody

A11226 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD300e Antibody (CD300E) detection.tested for IHC in Human.

CD300E cloning plasmid

CSB-CL673210HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: ATGTGGCTGCTCCCAGCTCTACTCCTTCTCTGCCTCTCAGGCTGTTTGTCTCTGAAGGGCCCCGGCTCTGTGACTGGCACTGCGGGGGACTCTCTGACAGTGTGGTGTCAGTATGAGAGCATGTACAAGGGATATAACAAGTACTGGTGCCGAGGACAGTACGACACGTCATGTGA
  • Show more
Description: A cloning plasmid for the CD300E gene.

Rabbit CMRF35 like molecule 2(CD300E) ELISA kit

E04C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CMRF35 like molecule 2(CD300E) ELISA kit

E04C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CMRF35 like molecule 2(CD300E) ELISA kit

E04C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Hu CD300e Purified

11-728-C025 0.025 mg
EUR 99

Anti-Hu CD300e Purified

11-728-C100 0.1 mg
EUR 158

Anti-Hu CD300e APC

1A-728-T025 25 tests
EUR 140

Anti-Hu CD300e APC

1A-728-T100 100 tests
EUR 240

Anti-Hu CD300e PE

1P-728-T025 25 tests
EUR 140

Anti-Hu CD300e PE

1P-728-T100 100 tests
EUR 240

CD300E protein (His tag)

80R-3997 100 ug
EUR 349
Description: Recombinant Human CD300E protein

CD300E ELISA KIT|Human

EF004729 96 Tests
EUR 689

Human CD300E shRNA Plasmid

20-abx967397
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CD300E shRNA Plasmid

20-abx981107
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD300E Human Recombinant Protein

PROTQ496F6 Regular: 20ug
EUR 317
Description: CD300E Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (18-173 a.a) and having a molecular mass of 19.9kDa.;CD300E is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CD300E Recombinant Protein (Human)

RP037909 100 ug Ask for price

CD300E Recombinant Protein (Rat)

RP193925 100 ug Ask for price

CD300E Recombinant Protein (Mouse)

RP122510 100 ug Ask for price

CMRF35-Like Molecule 2 (CD300e) Antibody

abx140158-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

CMRF35-Like Molecule 2 (CD300e) Antibody

abx140408-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

CMRF35-Like Molecule 2 (CD300E) Antibody

abx030830-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 2 (CD300E) Antibody

abx030830-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CMRF35-like molecule 2 (CD300E) Antibody

20-abx323211
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 2 (CD300e) Antibody (APC)

abx140159-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

CMRF35-Like Molecule 2 (CD300e) Antibody (PE)

abx140160-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

Cd300e ORF Vector (Rat) (pORF)

ORF064643 1.0 ug DNA
EUR 506

CD300E ORF Vector (Human) (pORF)

ORF012637 1.0 ug DNA
EUR 354

Cd300e ORF Vector (Mouse) (pORF)

ORF040838 1.0 ug DNA
EUR 506

Anti-Hu CD300e Pacific Blue

PB-728-T100 100 tests
EUR 269

Anti-Hu CD300e Purified Low Endotoxin

12-728-C100 0.1 mg
EUR 158

CD300E sgRNA CRISPR Lentivector set (Human)

K0407601 3 x 1.0 ug
EUR 339

Cd300e sgRNA CRISPR Lentivector set (Rat)

K6163501 3 x 1.0 ug
EUR 339

Cd300e sgRNA CRISPR Lentivector set (Mouse)

K4031701 3 x 1.0 ug
EUR 339

CD300E sgRNA CRISPR Lentivector (Human) (Target 1)

K0407602 1.0 ug DNA
EUR 154

CD300E sgRNA CRISPR Lentivector (Human) (Target 2)

K0407603 1.0 ug DNA
EUR 154

CD300E sgRNA CRISPR Lentivector (Human) (Target 3)

K0407604 1.0 ug DNA
EUR 154

Cd300e sgRNA CRISPR Lentivector (Rat) (Target 1)

K6163502 1.0 ug DNA
EUR 154

Cd300e sgRNA CRISPR Lentivector (Rat) (Target 2)

K6163503 1.0 ug DNA
EUR 154

Cd300e sgRNA CRISPR Lentivector (Rat) (Target 3)

K6163504 1.0 ug DNA
EUR 154

Cd300e sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4031702 1.0 ug DNA
EUR 154

Cd300e sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4031703 1.0 ug DNA
EUR 154

Cd300e sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4031704 1.0 ug DNA
EUR 154

CD300E Protein Vector (Mouse) (pPB-C-His)

PV163350 500 ng
EUR 603

CD300E Protein Vector (Mouse) (pPB-N-His)

PV163351 500 ng
EUR 603

CD300E Protein Vector (Mouse) (pPM-C-HA)

PV163352 500 ng
EUR 603

CD300E Protein Vector (Mouse) (pPM-C-His)

PV163353 500 ng
EUR 603

CD300E Protein Vector (Rat) (pPB-C-His)

PV258570 500 ng
EUR 603

CD300E Protein Vector (Rat) (pPB-N-His)

PV258571 500 ng
EUR 603

CD300E Protein Vector (Rat) (pPM-C-HA)

PV258572 500 ng
EUR 603

CD300E Protein Vector (Rat) (pPM-C-His)

PV258573 500 ng
EUR 603

CD300E Protein Vector (Human) (pPB-C-His)

PV050545 500 ng
EUR 481

CD300E Protein Vector (Human) (pPB-N-His)

PV050546 500 ng
EUR 481

CD300E Protein Vector (Human) (pPM-C-HA)

PV050547 500 ng
EUR 481

CD300E Protein Vector (Human) (pPM-C-His)

PV050548 500 ng
EUR 481

Recombinant Human CD300E Protein, His, E.coli-1mg

QP11326-1mg 1mg
EUR 2757

Recombinant Human CD300E Protein, His, E.coli-20ug

QP11326-20ug 20ug
EUR 201

Recombinant Human CD300E Protein, His, E.coli-5ug

QP11326-5ug 5ug
EUR 155

Cd300e 3'UTR GFP Stable Cell Line

TU153488 1.0 ml Ask for price

Cd300e 3'UTR Luciferase Stable Cell Line

TU103488 1.0 ml Ask for price

Cd300e 3'UTR Luciferase Stable Cell Line

TU201964 1.0 ml Ask for price

Cd300e 3'UTR GFP Stable Cell Line

TU251964 1.0 ml Ask for price

CD300E 3'UTR GFP Stable Cell Line

TU053948 1.0 ml
EUR 1521

CD300E 3'UTR Luciferase Stable Cell Line

TU003948 1.0 ml
EUR 1521

Rat CMRF35 like molecule 2(CD300E) ELISA kit

E02C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 2(CD300E) ELISA kit

E02C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 2(CD300E) ELISA kit

E02C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CMRF35 like molecule 2(CD300E) ELISA kit

E06C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CMRF35 like molecule 2(CD300E) ELISA kit

E06C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CMRF35 like molecule 2(CD300E) ELISA kit

E06C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CMRF35 like molecule 2(CD300E) ELISA kit

E03C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CMRF35 like molecule 2(CD300E) ELISA kit

E03C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CMRF35 like molecule 2(CD300E) ELISA kit

E03C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 2(CD300E) ELISA kit

E01C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 2(CD300E) ELISA kit

E01C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 2(CD300E) ELISA kit

E01C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CMRF35 like molecule 2(CD300E) ELISA kit

E07C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CMRF35 like molecule 2(CD300E) ELISA kit

E07C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CMRF35 like molecule 2(CD300E) ELISA kit

E07C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CMRF35 like molecule 2(CD300E) ELISA kit

E09C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CMRF35 like molecule 2(CD300E) ELISA kit

E09C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CMRF35 like molecule 2(CD300E) ELISA kit

E09C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CMRF35 like molecule 2(CD300E) ELISA kit

E08C1479-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CMRF35 like molecule 2(CD300E) ELISA kit

E08C1479-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CMRF35 like molecule 2(CD300E) ELISA kit

E08C1479-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35- like molecule 2, CD300E ELISA KIT

ELI-10372h 96 Tests
EUR 824

Mouse CMRF35- like molecule 2, Cd300e ELISA KIT

ELI-50514m 96 Tests
EUR 865

CD300E Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV654157 1.0 ug DNA
EUR 514

CD300E Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV654161 1.0 ug DNA
EUR 514

CD300E Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV654162 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

 

Scroll to Top