BTN3A1/2/3 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

BTN3A1/2/3 Polyclonal Antibody

ABP57930-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BTN3A1/2/3 protein at amino acid sequence of 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of BTN3A1/2/3 from Human. This BTN3A1/2/3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BTN3A1/2/3 protein at amino acid sequence of 41-90

BTN3A1/2/3 Polyclonal Antibody

ABP57930-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BTN3A1/2/3 protein at amino acid sequence of 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of BTN3A1/2/3 from Human. This BTN3A1/2/3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BTN3A1/2/3 protein at amino acid sequence of 41-90

BTN3A1/2/3 Polyclonal Antibody

ES8701-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BTN3A1/2/3 from Human. This antibody is tested and validated for IHC, WB, ELISA

BTN3A1/2/3 Polyclonal Antibody

ES8701-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BTN3A1/2/3 from Human. This antibody is tested and validated for IHC, WB, ELISA

BTN3A1/2/3 Polyclonal Conjugated Antibody

C46829 100ul
EUR 397

BTN3A1 Polyclonal Antibody

27356-100ul 100ul
EUR 252

BTN3A1 Polyclonal Antibody

27356-50ul 50ul
EUR 187

BTN3A1 Polyclonal Antibody

A58270 100 µg
EUR 570.55
Description: reagents widely cited

Anti-BTN3A1/2/3 Antibody

A04257 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for BTN3A1/2/3 Antibody (BTN3A1) detection.tested for IHC in Human.

Anti-BTN3A1/2/3 antibody

STJ98764 200 µl
EUR 197
Description: Rabbit polyclonal to BTN3A1/2/3.

BTN3A1 Rabbit pAb

A10288-100ul 100 ul
EUR 308

BTN3A1 Rabbit pAb

A10288-200ul 200 ul
EUR 459

BTN3A1 Rabbit pAb

A10288-20ul 20 ul
EUR 183

BTN3A1 Rabbit pAb

A10288-50ul 50 ul
EUR 223

BTN3A1 Polyclonal Conjugated Antibody

C27356 100ul
EUR 397

BTN3A1 Antibody

1-CSB-PA002873LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BTN3A1. Recognizes BTN3A1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

BTN3A1 Antibody

DF12859 200ul
EUR 304
Description: BTN3A1 Antibody detects endogenous levels of BTN3A1.

Polyclonal BTN3A1 Antibody (C-term)

APR03824G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BTN3A1 (C-term). This antibody is tested and proven to work in the following applications:

BTN3A1 Polyclonal Antibody, Biotin Conjugated

A58271 100 µg
EUR 570.55
Description: Ask the seller for details

BTN3A1 Polyclonal Antibody, FITC Conjugated

A58272 100 µg
EUR 570.55
Description: The best epigenetics products

BTN3A1 Polyclonal Antibody, HRP Conjugated

A58273 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- BTN3A1 antibody

FNab00983 100µg
EUR 505.25
  • Immunogen: butyrophilin, subfamily 3, member A1
  • Uniprot ID: O00481
  • Gene ID: 11119
  • Research Area: Immunology, Metabolism, Developmental biology
Description: Antibody raised against BTN3A1

Anti-BTN3A1 antibody

PAab00983 100 ug
EUR 355

Anti-BTN3A1 antibody

STJ112326 100 µl
EUR 277

Rabbit Polyclonal Antibody to Human Topoisomerase IIb

TG2010-3 250 units
EUR 414

Anti-14-3-3 alpha + beta Rabbit Monoclonal Antibody

M02431-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal 14-3-3 alpha + beta Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Anti-active Caspase-3 Rabbit Monoclonal Antibody

M00334-3 100ug/vial
EUR 397
Description: Anti-active Caspase-3 Rabbit Monoclonal Antibody tested for IF, IHC, ICC, WB in Human

BTN3A1 siRNA

20-abx909397
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)

TG2012-2 250 ul
EUR 380

Anti-14-3-3 Rabbit Monoclonal Antibody

M02431-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal 14-3-3 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-Bcl-2 Rabbit Monoclonal Antibody

M00040-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.

BTN3A1 Antibody, HRP conjugated

1-CSB-PA002873LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BTN3A1. Recognizes BTN3A1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BTN3A1 Antibody, FITC conjugated

1-CSB-PA002873LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BTN3A1. Recognizes BTN3A1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BTN3A1 Antibody, Biotin conjugated

1-CSB-PA002873LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BTN3A1. Recognizes BTN3A1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Sumo2/3 Rabbit Monoclonal Antibody

M01282-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Sumo2/3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Butyrophilin Subfamily 3 Member A1 (BTN3A1) Antibody

abx027428-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Butyrophilin Subfamily 3 Member A1 (BTN3A1) Antibody

abx027428-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Butyrophilin Subfamily 3 Member A1 (BTN3A1) Antibody

20-abx125582
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Butyrophilin Subfamily 3 Member A1 (BTN3A1) Antibody

20-abx318335
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Butyrophilin Subfamily 3 Member A1 (BTN3A1) Antibody

abx230983-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-EIF4A1/2/3 Antibody

A03922-2 100ug/vial
EUR 334

Anti-Caspase-3 p12 Rabbit Monoclonal Antibody

M00334-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-3 p12 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

BTN3A1 Blocking Peptide

DF12859-BP 1mg
EUR 195

BTN3A1 cloning plasmid

CSB-CL002873HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1542
  • Sequence: ATGAAAATGGCAAGTTTCCTGGCCTTCCTTCTGCTCAACTTTCGTGTCTGCCTCCTTTTGCTTCAGCTGCTCATGCCTCACTCAGCTCAGTTTTCTGTGCTTGGACCCTCTGGGCCCATCCTGGCCATGGTGGGTGAAGACGCTGATCTGCCCTGTCACCTGTTCCCGACCATGA
  • Show more
Description: A cloning plasmid for the BTN3A1 gene.

Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348

M00084-2 100uL
EUR 397
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human

Anti-PARP Rabbit Monoclonal Antibody

M00122-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal PARP Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-p21 Rabbit Monoclonal Antibody

M00145-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal p21 Antibody. Validated in IP, IF, IHC, WB and tested in Human.

Anti-PAX6 Rabbit Monoclonal Antibody

M00273-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX6 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Actin Rabbit Monoclonal Antibody

M02014-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Actin Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Ubiquitin Rabbit Monoclonal Antibody

M02848-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Ubiquitin Antibody. Validated in Flow Cytometry, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Butyrophilin Subfamily 3 Member A1 (BTN3A1) Antibody (HRP)

20-abx303218
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Butyrophilin Subfamily 3 Member A1 (BTN3A1) Antibody (FITC)

20-abx303219
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Butyrophilin Subfamily 3 Member A1 (BTN3A1) Antibody (Biotin)

20-abx303220
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

BTN3A1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0201703 1.0 ug DNA
EUR 154

Anti-Mutant p53 Rabbit Monoclonal Antibody

M00001-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Mutant p53 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Caspase-9 Rabbit Monoclonal Antibody

M00080-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-9 Antibody. Validated in IP, IF, IHC, WB and tested in Human.

Anti-CDK1/Cdc2 Rabbit Monoclonal Antibody

M00209-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal CDK1/Cdc2 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-Cyclin B1 Rabbit Monoclonal Antibody

M00745-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cyclin B1 Antibody. Validated in IP, IF, IHC, WB and tested in Human.

Anti-Hsp90 alpha Rabbit Monoclonal Antibody

M01103-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Hsp90 alpha Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

BTN3A1 ELISA KIT|Human

EF008171 96 Tests
EUR 689

Human BTN3A1 shRNA Plasmid

20-abx957605
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BTN3A1 Recombinant Protein (Human)

RP037063 100 ug Ask for price

Anti-PTEN Rabbit Monoclonal Antibody, Clone#RM265

M00006-3 100uL
EUR 385
Description: Anti-PTEN Rabbit Monoclonal Antibody, Clone#RM265 tested in WB, IHC, reactive to Human (Mouse)

Anti-Akt1 Rabbit Monoclonal Antibody, Clone#RM252

M00024-3 100ul
EUR 375
Description: Anti-Akt1 Rabbit Monoclonal Antibody, Clone#RM252 tested in WB, IHC, reactive to Human (Mouse, Rat)

Anti-CD29 Rabbit Monoclonal Antibody, Clone#RM285

M00772-3 100uL
EUR 397
Description: Anti-CD29 Rabbit Monoclonal Antibody, Clone#RM285 tested in WB, IHC, reactive to Human

Anti-CD3E Rabbit Monoclonal Antibody, Clone#RM344

M02675-3 100uL
EUR 397
Description: Anti-CD3E Rabbit Monoclonal Antibody, Clone#RM344 tested in WB, IHC, reactive to Human

Anti-Phospho-p53 (S9) Rabbit Monoclonal Antibody

P00001-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-p53 (S9) Antibody. Validated in WB and tested in Human.

Anti-Phospho-EGFR (Y1068) Rabbit Monoclonal Antibody

P00023-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-EGFR (Y1068) Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Phospho-AKT1 (S129) Rabbit Monoclonal Antibody

P00024-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-AKT1 (S129) Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-Phospho-MEK1 (S298) Rabbit Monoclonal Antibody

P00292-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-MEK1 (S298) Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Phospho-Raf1 (S43) Rabbit Monoclonal Antibody

P00446-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-Raf1 (S43) Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-Phospho-ATF2 (T71) Rabbit Monoclonal Antibody

P00916-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-ATF2 (T71) Antibody. Validated in IP, IF, ICC, WB and tested in Human.

Human Butyrophilin subfamily 3 member A1 (BTN3A1)

1-CSB-EP002873HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Butyrophilin subfamily 3 member A1(BTN3A1),partial expressed in E.coli

Human Butyrophilin subfamily 3 member A1 (BTN3A1)

1-CSB-YP002873HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 26.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Butyrophilin subfamily 3 member A1(BTN3A1),partial expressed in Yeast

BTN3A1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0201704 1.0 ug DNA
EUR 154

BTN3A1 3'UTR GFP Stable Cell Line

TU051973 1.0 ml
EUR 1521

BTN3A1 3'UTR Luciferase Stable Cell Line

TU001973 1.0 ml
EUR 1521

Anti-Dishevelled 2/DVL2 Antibody

A02404-3 100ug/vial
EUR 294

Anti-Polycystin 2/PKD2 Antibody

A00630-3 100ug/vial
EUR 334

Anti-EGF Receptor Rabbit Monoclonal Antibody, Clone#RM294

M00023-3 100uL
EUR 427
Description: Anti-EGF Receptor Rabbit Monoclonal Antibody, Clone#RM294 tested in WB, IHC, reactive to Human

Anti-ER alpha Rabbit Monoclonal Antibody, Clone#RM292

M00057-3 100uL
EUR 415
Description: Anti-ER alpha Rabbit Monoclonal Antibody, Clone#RM292 tested in WB, IHC, reactive to Human

Anti-p38 MAPK Rabbit Monoclonal Antibody, Clone#RM245

M00176-3 100ul
EUR 385
Description: Anti-p38 MAPK Rabbit Monoclonal Antibody, Clone#RM245 tested in WB, IHC, reactive to Human, (Rat, Mouse)

Anti-CEA (CD66e) Rabbit Monoclonal Antibody, Clone#RM326

M00356-3 100uL
EUR 385
Description: Anti-CEA (CD66e) Rabbit Monoclonal Antibody, Clone#RM326 tested in WB, IHC. ELISA, reactive to Human

Anti-Cytokeratin 5 Rabbit Monoclonal Antibody, Clone#RM226

M00398-3 100ul
EUR 375
Description: Anti-Cytokeratin 5 Rabbit Monoclonal Antibody, Clone#RM226 tested in WB, IHC, reactive to Human

Anti-alpha smooth muscle Actin Rabbit Monoclonal Antibody

M01072-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal alpha smooth muscle Actin Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-Napsin-A Rabbit Monoclonal Antibody, Clone#RM366

M05685-3 100uL
EUR 385
Description: Anti-Napsin-A Rabbit Monoclonal Antibody, Clone#RM366 tested in WB, IHC, reactive to Human

Anti-Human IgM Rabbit Monoclonal Antibody, Clone#RM121

M07469-3 100ug
EUR 375
Description: Anti-Human IgM Rabbit Monoclonal Antibody, Clone#RM121 tested in ICC, IHC, FC, ELISA, reactive to Human

Rabbit Complement Adsorbed

31063-3 100mL
EUR 246
  • All products from Pel-Freez are available in Europe and worldwide via Gentaur. If you cannot find the item you need send us an inquiry and we will be in touch with you with pricing and delivery information in less than 12 hours.
Description: The complement is collected from healthy 8-12 week old rabbits (both male and female) and stored at -70°C. It is in the form of frozen liquid. The Hemolytic titer is LOT dependant but generally above 1:16. The complement is extremely heat-sensitive. Prior to working with it we recommend that the complement is thawed on ice or in a cold water bath or under a stream of cold water. Never thaw using warm or hot water. While defrosted like this we advise you to make single-use aliquots and keep them frozen at -70C. Freeze-thaw cycles will damage the complement components and will reduce significantly the activity. Once thawed, the leftover from a working aliquot should be discarded.

Anti-VEGF Receptor 2/Kdr Antibody

A00901-3 100ug/vial
EUR 334

Anti-beta 2 Microglobulin/B2m Antibody

A00456-3 100ug/vial
EUR 294

Anti-E-Cadherin (CDH1) Rabbit Monoclonal Antibody, Clone#RM244

M00063-3 100ul
EUR 375
Description: Anti-E-Cadherin (CDH1) Rabbit Monoclonal Antibody, Clone#RM244 tested in WB, IHC, reactive to Human

Anti-Cyclin D1 (CCND1) Rabbit Monoclonal Antibody, Clone#RM241

M00149-3 100ul
EUR 375
Description: Anti-Cyclin D1 (CCND1) Rabbit Monoclonal Antibody, Clone#RM241 tested in WB, IHC, reactive to Human (Bovine, Mouse or Rat)

Anti-PR (Progesterone Receptor) Rabbit Monoclonal Antibody, Clone#RM357

M00541-3 100uL
EUR 385
Description: Anti-PR (Progesterone Receptor) Rabbit Monoclonal Antibody, Clone#RM357 tested in WB, IHC, reactive to Human

Anti-Androgen Receptor (AR-V7 specific) Rabbit Monoclonal Antibody

M00542-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Androgen Receptor (AR-V7 specific) Antibody. Validated in IHC, WB and tested in Human.

Anti-Arginase-1 (ARG1) Rabbit Monoclonal Antibody, Clone#RM377

M01106-3 100uL
EUR 385
Description: Anti-Arginase-1 (ARG1) Rabbit Monoclonal Antibody, Clone#RM377 tested in WB, IHC, reactive to Human

Anti-CK18 (Cytokeratin-18) Rabbit Monoclonal Antibody, Clone#RM279

M01357-3 100uL
EUR 375
Description: Anti-CK18 (Cytokeratin-18) Rabbit Monoclonal Antibody, Clone#RM279 tested in WB, IHC, reactive to Human

Anti-CD31 (PECAM-1) Rabbit Monoclonal Antibody, Clone#RM247

M01513-3 100ul
EUR 375
Description: Anti-CD31 (PECAM-1) Rabbit Monoclonal Antibody, Clone#RM247 tested in WB, IHC, reactive to Human

Anti-CK7 (Cytokeratin-7) Rabbit Monoclonal Antibody, Clone#RM284

M02416-3 100uL
EUR 385
Description: Anti-CK7 (Cytokeratin-7) Rabbit Monoclonal Antibody, Clone#RM284 tested in WB, IHC, reactive to Human

Anti-Phospho-Stat3 (Tyr705) Rabbit Monoclonal Antibody, Clone#RM261

P00007-3 100uL
EUR 375
Description: Anti-Phospho-Stat3 (Tyr705) Rabbit Monoclonal Antibody, Clone#RM261 tested in WB, IHC, reactive to Human (Mouse, Rat)

Anti-Human IgG4 Fc Rabbit Monoclonal Antibody, Clone#RM217

M11385-3 100ug
EUR 410
Description: Anti-Human IgG4 Fc Rabbit Monoclonal Antibody, Clone#RM217 tested in FC, ELISA , reactive to Human

Anti-Histone H3 (mono methyl R2) Rabbit Monoclonal Antibody

M12477-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal Histone H3 (mono methyl R2) Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-p53 Rabbit Monoclonal Antibody

M00001-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p53 Antibody. Validated in ICC/IF, WB and tested in Human.

Anti-PTEN Rabbit Monoclonal Antibody

M00006-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PTEN Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-STAT3 Rabbit Monoclonal Antibody

M00007-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Rb Rabbit Monoclonal Antibody

M00039-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rb Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

Anti-Ras Rabbit Monoclonal Antibody

M00099-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Ras Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.

Anti-ERK1 Rabbit Monoclonal Antibody

M00104-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ERK1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-p21 Rabbit Monoclonal Antibody

M00145-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p21 Antibody. Validated in IF, ICC, WB and tested in Human, Mouse, Rat.

Anti-p38 Rabbit Monoclonal Antibody

M00176-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p38 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Rho Rabbit Monoclonal Antibody

M00207-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rho Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-GFAP Rabbit Monoclonal Antibody

M00213-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFAP Antibody. Validated in IF, IHC, WB and tested in Human, Rat.

Anti-LRRK2 Rabbit Monoclonal Antibody

M00221-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-MiTF Rabbit Monoclonal Antibody

M00269-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MiTF Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PAX6 Rabbit Monoclonal Antibody

M00273-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX6 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-MEK1 Rabbit Monoclonal Antibody

M00292-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MEK1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Survivin Rabbit Monoclonal Antibody

M00379-2 100ug/vial
EUR 397
Description: Anti-Survivin Rabbit Monoclonal Antibody tested for IP, IHC, WB in Mouse, Rat

Anti-Hsp27 Rabbit Monoclonal Antibody

M00676-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Hsp27 Antibody. Validated in Flow Cytometry and tested in Human, Mouse, Rat.

Anti-SOX10 Rabbit Monoclonal Antibody

M00758-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal SOX10 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PAX8 Rabbit Monoclonal Antibody

M00943-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX8 Antibody. Validated in IF, WB and tested in Human.

Anti-PGP9.5 Rabbit Monoclonal Antibody

M01018-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PGP9.5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Podoplanin Rabbit Monoclonal Antibody

M01124-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human.

Anti-CD74 Rabbit Monoclonal Antibody

M01340-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD74 Antibody. Validated in IF, WB and tested in Human.

Anti-CD31 Rabbit Monoclonal Antibody

M01513-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD31 Antibody. Validated in WB and tested in Human.

Anti-Actin Rabbit Monoclonal Antibody

M02014-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Actin Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Anti-MBP Rabbit Monoclonal Antibody

M30934-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MBP Antibody. Validated in WB and tested in All species.

Anti-GFP Rabbit Monoclonal Antibody

M30939-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFP Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Rabbit APRIL Recombinant Protein

R02417-3 5ug/vial
EUR 259
Description: A proliferation-inducing ligand (APRIL), also known as TNFSF13, is a member of the tumor necrosis factor (TNF) ligand superfamily. APRIL/TNFSF13 has been shown to play a role in protecting cells from undergoing apoptosis and promoting B cell development. Rabbit APRIL Recombinant Protein is purified APRIL (TNFSF13) produced in yeast.

Anti-Beta-Catenin 1 (CTNNB1) Rabbit Monoclonal Antibody, Clone#RM276

M00004-3 100uL
EUR 375
Description: Anti-Beta-Catenin 1 (CTNNB1) Rabbit Monoclonal Antibody, Clone#RM276 tested in WB, IHC, reactive to Human (Mouse or Rat)

Anti-CK-14 (Cytokeratin-14) Rabbit Monoclonal Antibody, Clone#RM328

M01432-3 100uL
EUR 385
Description: Anti-CK-14 (Cytokeratin-14) Rabbit Monoclonal Antibody, Clone#RM328 tested in WB, IHC, reactive to Human (Mouse or Rat)

Anti-Cytokeratin 17 (CK-17) Rabbit Monoclonal Antibody, Clone#RM351

M02101-3 100uL
EUR 397
Description: Anti-Cytokeratin 17 (CK-17) Rabbit Monoclonal Antibody, Clone#RM351 tested in WB, IHC, reactive to Human

Anti-Phospho-Rsk1 (Thr359/Ser363) Rabbit Monoclonal Antibody, Clone#RM233

P01058-3 100ul
EUR 375
Description: Anti-Phospho-Rsk1 (Thr359/Ser363) Rabbit Monoclonal Antibody, Clone#RM233 tested in WB, IHC, reactive to Human

Anti-Phospho-Histone H3 (Thr11) Rabbit Monoclonal Antibody, Clone#RM164

P06819-3 100ug
EUR 468
Description: Anti-Phospho-Histone H3 (Thr11) Rabbit Monoclonal Antibody, Clone#RM164 tested in WB, ELISA, Multiplex, reactive to All Vertebrates

Anti-Human Kappa Light Chain Rabbit Monoclonal Antibody, Clone#RM126

M05470-3 100ug
EUR 375
Description: Anti-Human Kappa Light Chain Rabbit Monoclonal Antibody, Clone#RM126 tested in ICC, IHC, FC, ELISA, reactive to Human

Anti-Monomethyl-Histone H3 (Lys4) Rabbit Monoclonal Antibody, Clone#RM140

M06819-3 100ug
EUR 479
Description: Anti-Monomethyl-Histone H3 (Lys4) Rabbit Monoclonal Antibody, Clone#RM140 tested in WB, ELISA, Multiplex, ChIP, ICC, reactive to All Vertebrates

Anti-Acetyl-alpha-Tubulin (Lys40) Rabbit Monoclonal Antibody, Clone#RM318

M08382-3 100uL
EUR 455
Description: Anti-Acetyl-alpha-Tubulin (Lys40) Rabbit Monoclonal Antibody, Clone#RM318 tested in WB, ICC, reactive to All Vertebrates

 

Scroll to Top