RNF6 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

RNF6 Polyclonal Antibody

ABP60222-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RNF6 protein at amino acid sequence of 470-550
  • Applications tips:
Description: A polyclonal antibody for detection of RNF6 from Human. This RNF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF6 protein at amino acid sequence of 470-550

RNF6 Polyclonal Antibody

ES9106-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RNF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RNF6 Polyclonal Antibody

ES9106-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RNF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RNF6 Rabbit pAb

A14572-100ul 100 ul
EUR 308

RNF6 Rabbit pAb

A14572-200ul 200 ul
EUR 459

RNF6 Rabbit pAb

A14572-20ul 20 ul
EUR 183

RNF6 Rabbit pAb

A14572-50ul 50 ul
EUR 223

RNF6 antibody

20R-1156 100 ug
EUR 377
Description: Rabbit polyclonal RNF6 antibody

RNF6 antibody

70R-19930 50 ul
EUR 435
Description: Rabbit polyclonal RNF6 antibody

RNF6 antibody

70R-2741 50 ug
EUR 467
Description: Rabbit polyclonal RNF6 antibody

RNF6 antibody

70R-3063 50 ug
EUR 467
Description: Rabbit polyclonal RNF6 antibody

RNF6 Antibody

45567-100ul 100ul
EUR 252

RNF6 Antibody

45567-50ul 50ul
EUR 187

RNF6 Antibody

1-CSB-PA897080LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

RNF6 Antibody

DF8890 200ul
EUR 304
Description: RNF6 Antibody detects endogenous levels of total RNF6.

RNF6 Antibody

1-CSB-PA019896GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

RNF6 Antibody

ABD8890 100 ug
EUR 438

RNF6 Conjugated Antibody

C45567 100ul
EUR 397

anti- RNF6 antibody

FNab07360 100µg
EUR 585
  • Immunogen: ring finger protein(C3H2C3 type) 6
  • Uniprot ID: Q9Y252
  • Gene ID: 6049
  • Research Area: Epigenetics, Developmental biology
Description: Antibody raised against RNF6

Anti-RNF6 antibody

PAab07360 100 ug
EUR 412

Anti-RNF6 antibody

STJ116783 100 µl
EUR 277
Description: The protein encoded by this gene contains a RING-H2 finger motif. Deletions and mutations in this gene were detected in esophageal squamous cell carcinoma (ESCC), suggesting that this protein may be a potential tumor suppressor. Studies of the mouse counterpart suggested a role of this protein in the transcription regulation that controls germinal differentiation. Multiple alternatively spliced transcript variants encoding the same protein are observed.

Anti-RNF6 antibody

STJ190264 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RNF6

RNF6 siRNA

20-abx931804
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF6 siRNA

20-abx931805
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RNF6

YF-PA14404 50 ug
EUR 363
Description: Mouse polyclonal to RNF6

anti-RNF6

YF-PA14405 100 ul
EUR 403
Description: Rabbit polyclonal to RNF6

anti-RNF6

YF-PA24587 50 ul
EUR 334
Description: Mouse polyclonal to RNF6

RNF6 Antibody, HRP conjugated

1-CSB-PA897080LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RNF6 Antibody, FITC conjugated

1-CSB-PA897080LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RNF6 Antibody, Biotin conjugated

1-CSB-PA897080LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RNF6 Blocking Peptide

33R-5331 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF6 antibody, catalog no. 70R-2741

RNF6 Blocking Peptide

33R-9514 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF6 antibody, catalog no. 70R-3063

RNF6 Blocking Peptide

33R-5861 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF6 antibody, catalog no. 20R-1156

RNF6 cloning plasmid

CSB-CL897080HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2058
  • Sequence: atgaatcagtctagatcgagatcagatggtggcagtgaagaaaccttacctcaagaccataatcatcatgaaaatgagagaagatggcagcaagagcgtctccacagagaagaggcctattatcagtttattaatgaactcaatgatgaagattatcggcttatgagagaccata
  • Show more
Description: A cloning plasmid for the RNF6 gene.

RNF6 Blocking Peptide

DF8890-BP 1mg
EUR 195

Anti-RNF6 (3B1)

YF-MA15219 100 ug
EUR 363
Description: Mouse monoclonal to RNF6

Anti-RNF6 (6D5)

YF-MA15220 100 ug
EUR 363
Description: Mouse monoclonal to RNF6

Mouse E3 ubiquitin- protein ligase RNF6, Rnf6 ELISA KIT

ELI-15185m 96 Tests
EUR 865

Human E3 ubiquitin- protein ligase RNF6, RNF6 ELISA KIT

ELI-30259h 96 Tests
EUR 824

RNF6 ELISA KIT|Human

EF002528 96 Tests
EUR 689

Mouse RNF6 shRNA Plasmid

20-abx978105
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RNF6 shRNA Plasmid

20-abx954096
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-RNF6 Plasmid

PVT16115 2 ug
EUR 325

RNF6 Recombinant Protein (Human)

RP026698 100 ug Ask for price

RNF6 Recombinant Protein (Mouse)

RP168692 100 ug Ask for price

RNF6 Recombinant Protein (Mouse)

RP168695 100 ug Ask for price

RNF6 Recombinant Protein (Mouse)

RP168698 100 ug Ask for price

RNF6 Recombinant Protein (Mouse)

RP168701 100 ug Ask for price

RNF6 Recombinant Protein (Rat)

RP226463 100 ug Ask for price

Ring Finger Protein 6 (RNF6) Antibody

20-abx218330
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody

abx145267-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody

abx237360-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ring Finger Protein 6 (RNF6) Antibody

20-abx301117
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody (HRP)

20-abx317768
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody (FITC)

20-abx317769
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody (Biotin)

20-abx317770
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal RNF6 Antibody (monoclonal) (M01), Clone: 3B1

AMM04031G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RNF6 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B1. This antibody is applicable in WB and IF, E

Rnf6 ORF Vector (Rat) (pORF)

ORF075489 1.0 ug DNA
EUR 506

RNF6 ORF Vector (Human) (pORF)

ORF008900 1.0 ug DNA
EUR 95

Rnf6 ORF Vector (Mouse) (pORF)

ORF056232 1.0 ug DNA
EUR 506

Rnf6 ORF Vector (Mouse) (pORF)

ORF056233 1.0 ug DNA
EUR 506

Rnf6 ORF Vector (Mouse) (pORF)

ORF056234 1.0 ug DNA
EUR 506

Rnf6 ORF Vector (Mouse) (pORF)

ORF056235 1.0 ug DNA
EUR 506

Ring Finger Protein (C3H2C3 Type) 6 (RNF6) Antibody

20-abx115286
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rnf6 sgRNA CRISPR Lentivector set (Mouse)

K4790601 3 x 1.0 ug
EUR 339

Rnf6 sgRNA CRISPR Lentivector set (Rat)

K6716001 3 x 1.0 ug
EUR 339

RNF6 sgRNA CRISPR Lentivector set (Human)

K1834201 3 x 1.0 ug
EUR 339

Rnf6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4790602 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4790603 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4790604 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6716002 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6716003 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6716004 1.0 ug DNA
EUR 154

RNF6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1834202 1.0 ug DNA
EUR 154

RNF6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1834203 1.0 ug DNA
EUR 154

RNF6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1834204 1.0 ug DNA
EUR 154

RNF6 Protein Vector (Rat) (pPB-C-His)

PV301954 500 ng
EUR 1166

RNF6 Protein Vector (Rat) (pPB-N-His)

PV301955 500 ng
EUR 1166

RNF6 Protein Vector (Rat) (pPM-C-HA)

PV301956 500 ng
EUR 1166

RNF6 Protein Vector (Rat) (pPM-C-His)

PV301957 500 ng
EUR 1166

RNF6 Protein Vector (Human) (pPB-C-His)

PV035597 500 ng
EUR 329

RNF6 Protein Vector (Human) (pPB-N-His)

PV035598 500 ng
EUR 329

RNF6 Protein Vector (Human) (pPM-C-HA)

PV035599 500 ng
EUR 329

RNF6 Protein Vector (Human) (pPM-C-His)

PV035600 500 ng
EUR 329

RNF6 Protein Vector (Mouse) (pPB-C-His)

PV224926 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-N-His)

PV224927 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-HA)

PV224928 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-His)

PV224929 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-C-His)

PV224930 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-N-His)

PV224931 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-HA)

PV224932 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-His)

PV224933 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-C-His)

PV224934 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-N-His)

PV224935 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-HA)

PV224936 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-His)

PV224937 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-C-His)

PV224938 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-N-His)

PV224939 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-HA)

PV224940 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-His)

PV224941 500 ng
EUR 1065

Rnf6 3'UTR Luciferase Stable Cell Line

TU118016 1.0 ml Ask for price

Rnf6 3'UTR GFP Stable Cell Line

TU168016 1.0 ml Ask for price

Rnf6 3'UTR Luciferase Stable Cell Line

TU219565 1.0 ml Ask for price

Rnf6 3'UTR GFP Stable Cell Line

TU269565 1.0 ml Ask for price

RNF6 3'UTR GFP Stable Cell Line

TU070024 1.0 ml
EUR 2333

RNF6 3'UTR Luciferase Stable Cell Line

TU020024 1.0 ml
EUR 2333

Human Ring Finger Protein 6 (RNF6) ELISA Kit

abx382862-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RNF6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV623677 1.0 ug DNA
EUR 1355

RNF6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV623681 1.0 ug DNA
EUR 1355

RNF6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV623682 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

 

Scroll to Top