RNF6 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

RNF6 Polyclonal Antibody

ABP60222-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RNF6 protein at amino acid sequence of 470-550
  • Applications tips:
Description: A polyclonal antibody for detection of RNF6 from Human. This RNF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF6 protein at amino acid sequence of 470-550

RNF6 Polyclonal Antibody

ES9106-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RNF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RNF6 Polyclonal Antibody

ES9106-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RNF6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RNF6 Rabbit pAb

A14572-100ul 100 ul
EUR 308

RNF6 Rabbit pAb

A14572-200ul 200 ul
EUR 459

RNF6 Rabbit pAb

A14572-20ul 20 ul
EUR 183

RNF6 Rabbit pAb

A14572-50ul 50 ul
EUR 223

RNF6 antibody

20R-1156 100 ug
EUR 377
Description: Rabbit polyclonal RNF6 antibody

RNF6 antibody

70R-19930 50 ul
EUR 435
Description: Rabbit polyclonal RNF6 antibody

RNF6 antibody

70R-2741 50 ug
EUR 467
Description: Rabbit polyclonal RNF6 antibody

RNF6 antibody

70R-3063 50 ug
EUR 467
Description: Rabbit polyclonal RNF6 antibody

RNF6 Antibody

45567-100ul 100ul
EUR 252

RNF6 Antibody

45567-50ul 50ul
EUR 187

RNF6 Antibody

1-CSB-PA897080LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

RNF6 Antibody

DF8890 200ul
EUR 304
Description: RNF6 Antibody detects endogenous levels of total RNF6.

RNF6 Antibody

1-CSB-PA019896GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

RNF6 Antibody

ABD8890 100 ug
EUR 438

RNF6 Conjugated Antibody

C45567 100ul
EUR 397

anti- RNF6 antibody

FNab07360 100µg
EUR 585
  • Immunogen: ring finger protein(C3H2C3 type) 6
  • Uniprot ID: Q9Y252
  • Gene ID: 6049
  • Research Area: Epigenetics, Developmental biology
Description: Antibody raised against RNF6

Anti-RNF6 antibody

PAab07360 100 ug
EUR 412

Anti-RNF6 antibody

STJ116783 100 µl
EUR 277
Description: The protein encoded by this gene contains a RING-H2 finger motif. Deletions and mutations in this gene were detected in esophageal squamous cell carcinoma (ESCC), suggesting that this protein may be a potential tumor suppressor. Studies of the mouse counterpart suggested a role of this protein in the transcription regulation that controls germinal differentiation. Multiple alternatively spliced transcript variants encoding the same protein are observed.

Anti-RNF6 antibody

STJ190264 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RNF6

RNF6 siRNA

20-abx931804
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF6 siRNA

20-abx931805
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RNF6

YF-PA14404 50 ug
EUR 363
Description: Mouse polyclonal to RNF6

anti-RNF6

YF-PA14405 100 ul
EUR 403
Description: Rabbit polyclonal to RNF6

anti-RNF6

YF-PA24587 50 ul
EUR 334
Description: Mouse polyclonal to RNF6

RNF6 Antibody, HRP conjugated

1-CSB-PA897080LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RNF6 Antibody, FITC conjugated

1-CSB-PA897080LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RNF6 Antibody, Biotin conjugated

1-CSB-PA897080LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF6. Recognizes RNF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RNF6 Blocking Peptide

33R-5331 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF6 antibody, catalog no. 70R-2741

RNF6 Blocking Peptide

33R-9514 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF6 antibody, catalog no. 70R-3063

RNF6 Blocking Peptide

33R-5861 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF6 antibody, catalog no. 20R-1156

RNF6 cloning plasmid

CSB-CL897080HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2058
  • Sequence: atgaatcagtctagatcgagatcagatggtggcagtgaagaaaccttacctcaagaccataatcatcatgaaaatgagagaagatggcagcaagagcgtctccacagagaagaggcctattatcagtttattaatgaactcaatgatgaagattatcggcttatgagagaccata
  • Show more
Description: A cloning plasmid for the RNF6 gene.

RNF6 Blocking Peptide

DF8890-BP 1mg
EUR 195

Anti-RNF6 (3B1)

YF-MA15219 100 ug
EUR 363
Description: Mouse monoclonal to RNF6

Anti-RNF6 (6D5)

YF-MA15220 100 ug
EUR 363
Description: Mouse monoclonal to RNF6

Mouse E3 ubiquitin- protein ligase RNF6, Rnf6 ELISA KIT

ELI-15185m 96 Tests
EUR 865

Human E3 ubiquitin- protein ligase RNF6, RNF6 ELISA KIT

ELI-30259h 96 Tests
EUR 824

RNF6 ELISA KIT|Human

EF002528 96 Tests
EUR 689

Mouse RNF6 shRNA Plasmid

20-abx978105
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RNF6 shRNA Plasmid

20-abx954096
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-RNF6 Plasmid

PVT16115 2 ug
EUR 325

RNF6 Recombinant Protein (Human)

RP026698 100 ug Ask for price

RNF6 Recombinant Protein (Mouse)

RP168692 100 ug Ask for price

RNF6 Recombinant Protein (Mouse)

RP168695 100 ug Ask for price

RNF6 Recombinant Protein (Mouse)

RP168698 100 ug Ask for price

RNF6 Recombinant Protein (Mouse)

RP168701 100 ug Ask for price

RNF6 Recombinant Protein (Rat)

RP226463 100 ug Ask for price

Ring Finger Protein 6 (RNF6) Antibody

20-abx218330
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody

abx145267-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody

abx237360-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ring Finger Protein 6 (RNF6) Antibody

20-abx301117
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody (HRP)

20-abx317768
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody (FITC)

20-abx317769
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 6 (RNF6) Antibody (Biotin)

20-abx317770
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal RNF6 Antibody (monoclonal) (M01), Clone: 3B1

AMM04031G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RNF6 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B1. This antibody is applicable in WB and IF, E

Rnf6 ORF Vector (Rat) (pORF)

ORF075489 1.0 ug DNA
EUR 506

RNF6 ORF Vector (Human) (pORF)

ORF008900 1.0 ug DNA
EUR 95

Rnf6 ORF Vector (Mouse) (pORF)

ORF056232 1.0 ug DNA
EUR 506

Rnf6 ORF Vector (Mouse) (pORF)

ORF056233 1.0 ug DNA
EUR 506

Rnf6 ORF Vector (Mouse) (pORF)

ORF056234 1.0 ug DNA
EUR 506

Rnf6 ORF Vector (Mouse) (pORF)

ORF056235 1.0 ug DNA
EUR 506

Ring Finger Protein (C3H2C3 Type) 6 (RNF6) Antibody

20-abx115286
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rnf6 sgRNA CRISPR Lentivector set (Mouse)

K4790601 3 x 1.0 ug
EUR 339

Rnf6 sgRNA CRISPR Lentivector set (Rat)

K6716001 3 x 1.0 ug
EUR 339

RNF6 sgRNA CRISPR Lentivector set (Human)

K1834201 3 x 1.0 ug
EUR 339

Rnf6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4790602 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4790603 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4790604 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6716002 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6716003 1.0 ug DNA
EUR 154

Rnf6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6716004 1.0 ug DNA
EUR 154

RNF6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1834202 1.0 ug DNA
EUR 154

RNF6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1834203 1.0 ug DNA
EUR 154

RNF6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1834204 1.0 ug DNA
EUR 154

RNF6 Protein Vector (Rat) (pPB-C-His)

PV301954 500 ng
EUR 1166

RNF6 Protein Vector (Rat) (pPB-N-His)

PV301955 500 ng
EUR 1166

RNF6 Protein Vector (Rat) (pPM-C-HA)

PV301956 500 ng
EUR 1166

RNF6 Protein Vector (Rat) (pPM-C-His)

PV301957 500 ng
EUR 1166

RNF6 Protein Vector (Human) (pPB-C-His)

PV035597 500 ng
EUR 329

RNF6 Protein Vector (Human) (pPB-N-His)

PV035598 500 ng
EUR 329

RNF6 Protein Vector (Human) (pPM-C-HA)

PV035599 500 ng
EUR 329

RNF6 Protein Vector (Human) (pPM-C-His)

PV035600 500 ng
EUR 329

RNF6 Protein Vector (Mouse) (pPB-C-His)

PV224926 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-N-His)

PV224927 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-HA)

PV224928 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-His)

PV224929 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-C-His)

PV224930 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-N-His)

PV224931 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-HA)

PV224932 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-His)

PV224933 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-C-His)

PV224934 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-N-His)

PV224935 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-HA)

PV224936 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPM-C-His)

PV224937 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-C-His)

PV224938 500 ng
EUR 1065

RNF6 Protein Vector (Mouse) (pPB-N-His)

PV224939 500 ng
EUR 1065

 

Scroll to Top