ATG10 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

ATG10 Polyclonal Antibody
ABP57837-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50 Applications tips:
Description: A polyclonal antibody for detection of ATG10 from Human. This ATG10 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG10 protein at amino acid sequence of 1-50

ATG10 Polyclonal Antibody
A67182	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ATG10 Polyclonal Antibody
46882-100ul	SAB	100ul	EUR 252

ATG10 Polyclonal Antibody
46882-50ul	SAB	50ul	EUR 187

ATG10 Rabbit pAb
A7390-100ul	Abclonal	100 ul	EUR 308

ATG10 Rabbit pAb
A7390-200ul	Abclonal	200 ul	EUR 459

ATG10 Rabbit pAb
A7390-20ul	Abclonal	20 ul	EUR 183

ATG10 Rabbit pAb
A7390-50ul	Abclonal	50 ul	EUR 223

Polyclonal APG10/ATG10 Antibody
APR00221G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human APG10/ATG10 . This antibody is tested and proven to work in the following applications:

ATG10 Polyclonal Conjugated Antibody
C46882	SAB	100ul	EUR 397

ATG10 antibody
70R-3584	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ATG10 antibody

ATG10 Antibody
ABD8366	Lifescience Market	100 ug	EUR 438

ATG10 Antibody
36115-100ul	SAB	100ul	EUR 252

ATG10 Antibody
24607-100ul	SAB	100ul	EUR 390

ATG10 antibody
70R-12183	Fitzgerald	100 ug	EUR 447
Description: Rabbit polyclonal ATG10 antibody

ATG10 Antibody
DF8366	Affbiotech	200ul	EUR 304
Description: ATG10 Antibody detects endogenous levels of total ATG10.

ATG10 Antibody
1-CSB-PA828297	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

ATG10 Antibody
1-CSB-PA861988ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ATG10 Antibody
1-CSB-PA861988LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

ATG10 Antibody
1-CSB-PA167980	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

Polyclonal ATG10 Antibody (N-term)
APR07066G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG10 (N-term). This antibody is tested and proven to work in the following applications:

ATG10 Polyclonal Antibody, HRP Conjugated
A67183	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

ATG10 Polyclonal Antibody, FITC Conjugated
A67184	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

ATG10 Polyclonal Antibody, Biotin Conjugated
A67185	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Anti-Apg10 (Atg10) Rabbit Monoclonal Antibody
M07803	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Apg10 (Atg10) Antibody. Validated in IP, WB and tested in Human.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
20-abx006473	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
20-abx320319	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
20-abx310646	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
abx448529-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody
20-abx225049	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

ATG10 Conjugated Antibody
C36115	SAB	100ul	EUR 397

ATG10 Antibody (Biotin)
abx447701-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

ATG10 Antibody (FITC)
abx447702-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

ATG10 Antibody (HRP)
abx447703-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

APG10/ATG10 Antibody
3910-100	Biovision		EUR 338

Human ATG10 Antibody
32244-05111	AssayPro	150 ug	EUR 261

Anti-ATG10 antibody
STJ98826	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to ATG10.

Anti-ATG10 antibody
STJ29527	St John's Laboratory	100 µl	EUR 277

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ALP)
abx447699-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (APC)
abx447700-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (PerCP)
abx447705-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (RPE)
abx447706-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (Streptavidin)
abx447707-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

ATG10 siRNA
20-abx908442	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ATG10 siRNA
20-abx908443	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 390)
abx447691-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 488)
abx447692-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 565)
abx447693-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 594)
abx447694-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 633)
abx447695-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 655)
abx447696-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 680)
abx447697-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (ATTO 700)
abx447698-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

ATG10 Antibody, HRP conjugated
1-CSB-PA861988LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ATG10 Antibody, FITC conjugated
1-CSB-PA861988LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ATG10 Antibody, Biotin conjugated
1-CSB-PA861988LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATG10. Recognizes ATG10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human ATG10
SPC-669D	Stressmarq	0.1mg	EUR 354
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is unconjugated.

Antibody for Human ATG10
SPC-669D-A390	Stressmarq	0.1mg	EUR 401
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 390.

Antibody for Human ATG10
SPC-669D-A488	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 488.

Antibody for Human ATG10
SPC-669D-A565	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 565.

Antibody for Human ATG10
SPC-669D-A594	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 594.

Antibody for Human ATG10
SPC-669D-A633	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 633.

Antibody for Human ATG10
SPC-669D-A655	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 655.

Antibody for Human ATG10
SPC-669D-A680	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 680.

Antibody for Human ATG10
SPC-669D-A700	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to ATTO 700.

Antibody for Human ATG10
SPC-669D-ALP	Stressmarq	0.1mg	EUR 394
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human ATG10
SPC-669D-APC	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to APC .

Antibody for Human ATG10
SPC-669D-APCCY7	Stressmarq	0.1mg	EUR 471
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to APC/Cy7.

Antibody for Human ATG10
SPC-669D-BI	Stressmarq	0.1mg	EUR 396
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Biotin.

Antibody for Human ATG10
SPC-669D-DY350	Stressmarq	0.1mg	EUR 414
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 350.

Antibody for Human ATG10
SPC-669D-DY405	Stressmarq	0.1mg	EUR 403
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 405.

Antibody for Human ATG10
SPC-669D-DY488	Stressmarq	0.1mg	EUR 393
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 488.

Antibody for Human ATG10
SPC-669D-DY594	Stressmarq	0.1mg	EUR 395
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 594.

Antibody for Human ATG10
SPC-669D-DY633	Stressmarq	0.1mg	EUR 390
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Dylight 633.

Antibody for Human ATG10
SPC-669D-FITC	Stressmarq	0.1mg	EUR 392
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to FITC.

Antibody for Human ATG10
SPC-669D-HRP	Stressmarq	0.1mg	EUR 388
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to HRP.

Antibody for Human ATG10
SPC-669D-P594	Stressmarq	0.1mg	EUR 407
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to PE/ATTO 594.

Antibody for Human ATG10
SPC-669D-PCP	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to PerCP.

Antibody for Human ATG10
SPC-669D-RPE	Stressmarq	0.1mg	EUR 397
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to RPE .

Antibody for Human ATG10
SPC-669D-STR	Stressmarq	0.1mg	EUR 398
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is conjugated to Streptavidin.

Antibody for Human ATG10
SPC-669S	Stressmarq	0.012mg	EUR 65
Description: A polyclonal antibody for ATG10 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human ATG10. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG10 antibody is unconjugated.

Human Ubiquitin-like-conjugating enzyme ATG10 (ATG10)
1-CSB-EP861988HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 52.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin-like-conjugating enzyme ATG10(ATG10) expressed in E.coli

Ubiquitin-Like-Conjugating Enzyme ATG10 (ATG10) Antibody (PE/ATTO 594)
abx447704-100ug	Abbexa	100 ug	EUR 592
Shipped within 5-12 working days.

ATG10 Blocking Peptide
33R-9235	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG10 antibody, catalog no. 70R-3584

ATG10 cloning plasmid
CSB-CL861988HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 651 Sequence: atgagttcattggagaaaaaacattccaacgttattgtgcagaattcattaaacattcacaacataggtgatagttgggaatggagaccatcaaaggactgttctgatggctacatgtgcaaaatacactttcaaattaagaatgggtctgtgatgtcacatctaggagcatctac Show more
Description: A cloning plasmid for the ATG10 gene.

ATG10 cloning plasmid
CSB-CL861988HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 663 Sequence: atggaagaagatgagttcattggagaaaaaacattccaacgttattgtgcagaattcattaaacattcacaacagataggtgatagttgggaatggagaccatcaaaggactgttctgatggctacatgtgcaaaatacactttcaaattaagaatgggtctgtgatgtcacatct Show more
Description: A cloning plasmid for the ATG10 gene.

ATG10 Blocking Peptide
DF8366-BP	Affbiotech	1mg	EUR 195

Autophagy Related 10 (ATG10) Antibody
20-abx211898	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Autophagy Related 10 (ATG10) Antibody
20-abx211899	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Apg10 (Atg10) recombinant monoclonal antibody
A5711	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human Apg10 (Atg10) for WB ,ELISA

Human ATG10 Antibody (Biotin Conjugate)
32244-05121	AssayPro	150 ug	EUR 369

Mouse Ubiquitin- like- conjugating enzyme ATG10, Atg10 ELISA KIT
ELI-24028m	Lifescience Market	96 Tests	EUR 865

Human Ubiquitin- like- conjugating enzyme ATG10, ATG10 ELISA KIT
ELI-34706h	Lifescience Market	96 Tests	EUR 824

Autophagy Related 10 (ATG10) Antibody (HRP)
20-abx310647	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Autophagy Related 10 (ATG10) Antibody (FITC)
20-abx310648	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Autophagy Related 10 (ATG10) Antibody (Biotin)
20-abx310649	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human ATG10 AssayLite Antibody (FITC Conjugate)
32244-05141	AssayPro	150 ug	EUR 428

Human ATG10 AssayLite Antibody (RPE Conjugate)
32244-05151	AssayPro	150 ug	EUR 428

Human ATG10 AssayLite Antibody (APC Conjugate)
32244-05161	AssayPro	150 ug	EUR 428

Human ATG10 AssayLite Antibody (PerCP Conjugate)
32244-05171	AssayPro	150 ug	EUR 471

Mouse ATG10 shRNA Plasmid
20-abx975785	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ATG10 shRNA Plasmid
20-abx963181	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ATG10 protein (His tag)
80R-2494	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant ATG10 protein (His tag)

ATG10 Recombinant Protein (Human)
RP002188	ABM	100 ug	Ask for price

ATG10 Recombinant Protein (Human)
RP002191	ABM	100 ug	Ask for price

pCMV-Myc-ATG10 Plasmid
PVTB00420-2a	Lifescience Market	2 ug	EUR 356

pCMV-SPORT6-ATG10 Plasmid
PVT16512	Lifescience Market	2 ug	EUR 325

ATG10 Recombinant Protein (Rat)
RP191300	ABM	100 ug	Ask for price

ATG10 Recombinant Protein (Mouse)
RP117734	ABM	100 ug	Ask for price

ATG10 ORF Vector (Human) (pORF)
ORF000730	ABM	1.0 ug DNA	EUR 95

ATG10 ORF Vector (Human) (pORF)
ORF000731	ABM	1.0 ug DNA	EUR 95

Atg10 ORF Vector (Mouse) (pORF)
ORF039246	ABM	1.0 ug DNA	EUR 506

Atg10 ORF Vector (Rat) (pORF)
ORF063768	ABM	1.0 ug DNA	EUR 506

ATG10 sgRNA CRISPR Lentivector set (Human)
K0142801	ABM	3 x 1.0 ug	EUR 339

Atg10 sgRNA CRISPR Lentivector set (Mouse)
K4763001	ABM	3 x 1.0 ug	EUR 339

Atg10 sgRNA CRISPR Lentivector set (Rat)
K6746201	ABM	3 x 1.0 ug	EUR 339

ATG10-AS1 ORF Vector (Human) (pORF)
ORF015904	ABM	1.0 ug DNA	Ask for price

ATG10-IT1 ORF Vector (Human) (pORF)
ORF015905	ABM	1.0 ug DNA	Ask for price

ATG10 sgRNA CRISPR Lentivector (Human) (Target 1)
K0142802	ABM	1.0 ug DNA	EUR 154

ATG10 sgRNA CRISPR Lentivector (Human) (Target 2)
K0142803	ABM	1.0 ug DNA	EUR 154

ATG10 sgRNA CRISPR Lentivector (Human) (Target 3)
K0142804	ABM	1.0 ug DNA	EUR 154

Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4763002	ABM	1.0 ug DNA	EUR 154

Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4763003	ABM	1.0 ug DNA	EUR 154

Atg10 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4763004	ABM	1.0 ug DNA	EUR 154

Atg10 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6746202	ABM	1.0 ug DNA	EUR 154

Atg10 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6746203	ABM	1.0 ug DNA	EUR 154

Atg10 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6746204	ABM	1.0 ug DNA	EUR 154

ATG10 Autophagy Related 10 Human Recombinant Protein
PROTQ9H0Y0	BosterBio	Regular: 20ug	EUR 317
Description: ATG10 Human Recombinant produced in E. coli is a single polypeptide chain containing 243 amino acids (1-220) and having a molecular mass of 27.7 kDa.;ATG10 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ATG10 Protein Vector (Human) (pPB-C-His)
PV002917	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPB-N-His)
PV002918	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPM-C-HA)
PV002919	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPM-C-His)
PV002920	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPB-C-His)
PV002921	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPB-N-His)
PV002922	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPM-C-HA)
PV002923	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPM-C-His)
PV002924	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPB-His-MBP)
PV324714	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPB-His-GST)
PV324715	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPB-His-MBP)
PV324718	ABM	500 ng	EUR 329

ATG10 Protein Vector (Human) (pPB-His-GST)
PV324719	ABM	500 ng	EUR 329

ATG10 Protein Vector (Rat) (pPB-C-His)
PV255070	ABM	500 ng	EUR 603

ATG10 Protein Vector (Rat) (pPB-N-His)
PV255071	ABM	500 ng	EUR 603

ATG10 Protein Vector (Rat) (pPM-C-HA)
PV255072	ABM	500 ng	EUR 603

ATG10 Protein Vector (Rat) (pPM-C-His)
PV255073	ABM	500 ng	EUR 603

ATG10 Protein Vector (Mouse) (pPB-C-His)
PV156982	ABM	500 ng	EUR 603

ATG10 Protein Vector (Mouse) (pPB-N-His)
PV156983	ABM	500 ng	EUR 603

ATG10 Protein Vector (Mouse) (pPM-C-HA)
PV156984	ABM	500 ng	EUR 603

ATG10 Protein Vector (Mouse) (pPM-C-His)
PV156985	ABM	500 ng	EUR 603

Atg10 3'UTR Luciferase Stable Cell Line
TU201021	ABM	1.0 ml	Ask for price

Atg10 3'UTR GFP Stable Cell Line
TU152261	ABM	1.0 ml	Ask for price

ATG10 3'UTR Luciferase Stable Cell Line
TU001346	ABM	1.0 ml	EUR 1521

Atg10 3'UTR Luciferase Stable Cell Line
TU102261	ABM	1.0 ml	Ask for price

ATG10 3'UTR GFP Stable Cell Line
TU051346	ABM	1.0 ml	EUR 1521

Atg10 3'UTR GFP Stable Cell Line
TU251021	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC