TAL2 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

TAL2 Polyclonal Antibody

ES9066-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TAL2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TAL2 Rabbit pAb

A14788-100ul 100 ul
EUR 308

TAL2 Rabbit pAb

A14788-200ul 200 ul
EUR 459

TAL2 Rabbit pAb

A14788-20ul 20 ul
EUR 183

TAL2 Rabbit pAb

A14788-50ul 50 ul
EUR 223

TAL2 Antibody

45526-100ul 100ul
EUR 252

TAL2 Antibody

45526-50ul 50ul
EUR 187

TAL2 Antibody

DF8832 200ul
EUR 304
Description: TAL2 Antibody detects endogenous levels of total TAL2.

Tal2 antibody

70R-8195 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Tal2 antibody

TAL2 antibody

70R-8270 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TAL2 antibody

TAL2 Antibody

ABD8832 100 ug
EUR 438

Polyclonal TAL2 antibody - N-terminal region

APR00838G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TAL2 - N-terminal region. This antibody is tested and proven to work in the following applications:

TAL2 Conjugated Antibody

C45526 100ul
EUR 397

Anti-TAL2 antibody

STJ116988 100 µl
EUR 277
Description: This intronless gene encodes a helix-loop-helix protein. Translocations between this gene on chromosome 9 and the T-cell receptor beta-chain locus on chromosome 7 have been associated with activation of the T-cell acute lymphocytic leukemia 2 gene and T-cell acute lymphoblastic leukemia.

Anti-TAL2 antibody

STJ190224 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TAL2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TAL2 Blocking Peptide

33R-9261 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TAL2 antibody, catalog no. 70R-8270

TAL2 Blocking Peptide

DF8832-BP 1mg
EUR 195

TAL2 cloning plasmid

CSB-CL623085HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 327
  • Sequence: atgaccaggaagatcttcacaaataccagggagcggtggaggcagcagaatgtcaacagcgcctttgccaagctgaggaagctcatccccactcaccctccagacaaaaagctgagcaaaaatgaaacgcttcgcctggcaatgaggtatatcaacttcttggtcaaggtcttggg
  • Show more
Description: A cloning plasmid for the TAL2 gene.

Anti-TAL2 (1G6)

YF-MA15719 100 ug
EUR 363
Description: Mouse monoclonal to TAL2

Mouse Tal2 ELISA KIT

ELI-28960m 96 Tests
EUR 865


ELI-53089h 96 Tests
EUR 824

Mouse TAL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TAL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TAL2 Recombinant Protein (Rat)

RP232220 100 ug Ask for price

TAL2 Recombinant Protein (Human)

RP043933 100 ug Ask for price

TAL2 Recombinant Protein (Mouse)

RP177173 100 ug Ask for price

Tal2 ORF Vector (Rat) (pORF)

ORF077408 1.0 ug DNA
EUR 506

TAL2 ORF Vector (Human) (pORF)

ORF014645 1.0 ug DNA
EUR 354

Tal2 ORF Vector (Mouse) (pORF)

ORF059059 1.0 ug DNA
EUR 506

Tal2 sgRNA CRISPR Lentivector set (Rat)

K7514401 3 x 1.0 ug
EUR 339

TAL2 sgRNA CRISPR Lentivector set (Human)

K2330701 3 x 1.0 ug
EUR 339

Tal2 sgRNA CRISPR Lentivector set (Mouse)

K4002401 3 x 1.0 ug
EUR 339

T-Cell Acute Lymphocytic Leukemia Protein 2 (TAL2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tal2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7514402 1.0 ug DNA
EUR 154

Tal2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7514403 1.0 ug DNA
EUR 154

Tal2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7514404 1.0 ug DNA
EUR 154

TAL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2330702 1.0 ug DNA
EUR 154

TAL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2330703 1.0 ug DNA
EUR 154

TAL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2330704 1.0 ug DNA
EUR 154

Tal2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4002402 1.0 ug DNA
EUR 154

Tal2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4002403 1.0 ug DNA
EUR 154

Tal2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4002404 1.0 ug DNA
EUR 154

TAL2 Protein Vector (Rat) (pPB-C-His)

PV309630 500 ng
EUR 603

TAL2 Protein Vector (Rat) (pPB-N-His)

PV309631 500 ng
EUR 603

TAL2 Protein Vector (Rat) (pPM-C-HA)

PV309632 500 ng
EUR 603

TAL2 Protein Vector (Rat) (pPM-C-His)

PV309633 500 ng
EUR 603

TAL2 Protein Vector (Human) (pPB-C-His)

PV058577 500 ng
EUR 481

TAL2 Protein Vector (Human) (pPB-N-His)

PV058578 500 ng
EUR 481

TAL2 Protein Vector (Human) (pPM-C-HA)

PV058579 500 ng
EUR 481

TAL2 Protein Vector (Human) (pPM-C-His)

PV058580 500 ng
EUR 481

TAL2 Protein Vector (Mouse) (pPB-C-His)

PV236234 500 ng
EUR 603

TAL2 Protein Vector (Mouse) (pPB-N-His)

PV236235 500 ng
EUR 603

TAL2 Protein Vector (Mouse) (pPM-C-HA)

PV236236 500 ng
EUR 603

TAL2 Protein Vector (Mouse) (pPM-C-His)

PV236237 500 ng
EUR 603

Tal2 3'UTR Luciferase Stable Cell Line

TU120122 1.0 ml Ask for price

Tal2 3'UTR GFP Stable Cell Line

TU170122 1.0 ml Ask for price

Tal2 3'UTR Luciferase Stable Cell Line

TU221562 1.0 ml Ask for price

TAL2 3'UTR GFP Stable Cell Line

TU075113 1.0 ml
EUR 1394

Tal2 3'UTR GFP Stable Cell Line

TU271562 1.0 ml Ask for price

TAL2 3'UTR Luciferase Stable Cell Line

TU025113 1.0 ml
EUR 1394

TAL2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV638635 1.0 ug DNA
EUR 514

TAL2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV638639 1.0 ug DNA
EUR 514

TAL2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV638640 1.0 ug DNA
EUR 514

Recombinant Shigella Sonnei tal2 Protein (aa 1-316)

VAng-0223Lsx-1mgEcoli 1 mg (E. coli)
EUR 4477
Description: Shigella Sonnei (strain Ss046) Transaldolase 2, recombinant protein.

Recombinant Shigella Sonnei tal2 Protein (aa 1-316)

VAng-0223Lsx-500gEcoli 500 µg (E. coli)
EUR 2979
Description: Shigella Sonnei (strain Ss046) Transaldolase 2, recombinant protein.

Recombinant Shigella Sonnei tal2 Protein (aa 1-316)

VAng-0223Lsx-50gEcoli 50 µg (E. coli)
EUR 2044
Description: Shigella Sonnei (strain Ss046) Transaldolase 2, recombinant protein.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET


Scroll to Top