NMUR2 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

NMUR2 Polyclonal Antibody
ABP59482-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of NMUR2 from Human. This NMUR2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50

NMUR2 Polyclonal Antibody
ABP59482-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of NMUR2 from Human. This NMUR2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50

NMUR2 Polyclonal Antibody
ES8867-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NMUR2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NMUR2 Polyclonal Antibody
ES8867-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NMUR2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NMUR2 Rabbit pAb
A12812-100ul 100 ul
EUR 308

NMUR2 Rabbit pAb
A12812-200ul 200 ul
EUR 459

NMUR2 Rabbit pAb
A12812-20ul 20 ul
EUR 183

NMUR2 Rabbit pAb
A12812-50ul 50 ul
EUR 223

NMUR2 Polyclonal Conjugated Antibody
C46916 100ul
EUR 397

NMUR2 antibody
20R-NR014 50 ug
EUR 656
Description: Rabbit polyclonal NMUR2 antibody

NMUR2 antibody
70R-1539 100 ug
EUR 377
Description: Rabbit polyclonal NMUR2 antibody raised against the N terminal of NMUR2

NMUR2 Antibody
44978-100ul 100ul
EUR 252

NMUR2 Antibody
44978-50ul 50ul
EUR 187

NMUR2 Antibody
1-CSB-PA135689
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NMUR2. Recognizes NMUR2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

NMUR2 Antibody
DF2821 200ul
EUR 304
Description: NMUR2 antibody detects endogenous levels of total NMUR2.

NMUR2 antibody
70R-5107 50 ug
EUR 467
Description: Rabbit polyclonal NMUR2 antibody raised against the N terminal of NMUR2

NMUR2 Antibody
ABD2821 100 ug
EUR 438

Polyclonal NMUR2 Antibody (N-Terminus)
AMM06736G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal NMUR2 antibody - N-terminal region
AMM06737G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal NMUR2 antibody - N-terminal region
AMM06738G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 - N-terminal region. This antibody is tested and proven to work in the following applications:

Nmur2/ Rat Nmur2 ELISA Kit
ELI-15102r 96 Tests
EUR 886

NMUR2 Conjugated Antibody
C44978 100ul
EUR 397

Anti-NMUR2 antibody
STJ114678 100 µl
EUR 277
Description: This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight.

Anti-NMUR2 antibody
STJ99340 200 µl
EUR 197
Description: Rabbit polyclonal to NMUR2.

NMUR2 siRNA
20-abx903588
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NMUR2 siRNA
20-abx926087
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NMUR2 siRNA
20-abx926088
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NMUR2 Blocking Peptide
33R-6432 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NMUR2 antibody, catalog no. 70R-1539

NMUR2 Blocking Peptide
DF2821-BP 1mg
EUR 195

NMUR2 cloning plasmid
CSB-CL875632HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1248
  • Sequence: atgtcagggatggaaaaacttcagaatgcttcctggatctaccagcagaaactagaagatccattccagaaacacctgaacagcaccgaggagtatctggccttcctctgcggacctcggcgcagccacttcttcctccccgtgtctgtggtgtatgtgccaatttttgtggtgg
  • Show more
Description: A cloning plasmid for the NMUR2 gene.

NMUR2 cloning plasmid
CSB-CL875632HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1248
  • Sequence: atgtcagggatggaaaaacttcagaatgcttcctggatctaccagcagaaactagaagatccattccagaaacacctgaacagcaccgaggagtatctggccttcctctgcggacctcggcgcagccacttcttcctccccgtgtctgtggtgtatgtgccaatttttgtggtgg
  • Show more
Description: A cloning plasmid for the NMUR2 gene.

pCMV-SPORT6-NMUR2
PVT13972 2 ug
EUR 391

Rat NMUR2 shRNA Plasmid
20-abx986147
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NMUR2 shRNA Plasmid
20-abx961225
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NMUR2 shRNA Plasmid
20-abx981024
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NMUR2 Recombinant Protein (Human)
RP021391 100 ug Ask for price

NMUR2 Recombinant Protein (Human)
RP021394 100 ug Ask for price

NMUR2 Recombinant Protein (Mouse)
RP154454 100 ug Ask for price

NMUR2 Recombinant Protein (Rat)
RP214145 100 ug Ask for price

Neuromedin U Receptor 2 (NMUR2) Antibody
20-abx147557
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuromedin U Receptor 2 (NMUR2) Antibody
20-abx324995
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit Anti-Human NMU receptor 2 (NMUR2) antiserum # 1
NMUR21-S 100 ul
EUR 457

Rabbit Anti-Rat NMU receptor 2 (NMUR2) antiserum #2
NMUR22-S 100 ul
EUR 457

Nmur2 ORF Vector (Rat) (pORF)
ORF071383 1.0 ug DNA
EUR 506

NMUR2 ORF Vector (Human) (pORF)
ORF007131 1.0 ug DNA
EUR 95

NMUR2 ORF Vector (Human) (pORF)
ORF007132 1.0 ug DNA
EUR 95

Nmur2 ORF Vector (Mouse) (pORF)
ORF051486 1.0 ug DNA
EUR 506

Rabbit Anti-Human NMU receptor 2 (NMUR2) IgG # 1, aff pure
NMUR21-A 100 ug
EUR 482

Rabbit Anti-Rat NMU receptor 2 (NMUR2) IgG # 2, aff pure
NMUR22-A 100 ug
EUR 482

Nmur2 sgRNA CRISPR Lentivector set (Rat)
K7097301 3 x 1.0 ug
EUR 339

Nmur2 sgRNA CRISPR Lentivector set (Mouse)
K3599401 3 x 1.0 ug
EUR 339

NMUR2 sgRNA CRISPR Lentivector set (Human)
K1437501 3 x 1.0 ug
EUR 339

Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7097302 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7097303 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7097304 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3599402 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3599403 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3599404 1.0 ug DNA
EUR 154

NMUR2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1437502 1.0 ug DNA
EUR 154

NMUR2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1437503 1.0 ug DNA
EUR 154

NMUR2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1437504 1.0 ug DNA
EUR 154

NMUR2 Protein Vector (Mouse) (pPB-C-His)
PV205942 500 ng
EUR 603

NMUR2 Protein Vector (Mouse) (pPB-N-His)
PV205943 500 ng
EUR 603

NMUR2 Protein Vector (Mouse) (pPM-C-HA)
PV205944 500 ng
EUR 603

NMUR2 Protein Vector (Mouse) (pPM-C-His)
PV205945 500 ng
EUR 603

NMUR2 Protein Vector (Rat) (pPB-C-His)
PV285530 500 ng
EUR 603

NMUR2 Protein Vector (Rat) (pPB-N-His)
PV285531 500 ng
EUR 603

NMUR2 Protein Vector (Rat) (pPM-C-HA)
PV285532 500 ng
EUR 603

NMUR2 Protein Vector (Rat) (pPM-C-His)
PV285533 500 ng
EUR 603

NMUR2 Protein Vector (Human) (pPB-C-His)
PV028521 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPB-N-His)
PV028522 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPM-C-HA)
PV028523 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPM-C-His)
PV028524 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPB-C-His)
PV028525 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPB-N-His)
PV028526 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPM-C-HA)
PV028527 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPM-C-His)
PV028528 500 ng
EUR 329

Nmur2 3'UTR Luciferase Stable Cell Line
TU114181 1.0 ml Ask for price

Nmur2 3'UTR GFP Stable Cell Line
TU164181 1.0 ml Ask for price

Nmur2 3'UTR Luciferase Stable Cell Line
TU214055 1.0 ml Ask for price

Nmur2 3'UTR GFP Stable Cell Line
TU264055 1.0 ml Ask for price

NMUR2 3'UTR GFP Stable Cell Line
TU065790 1.0 ml
EUR 1394

NMUR2 3'UTR Luciferase Stable Cell Line
TU015790 1.0 ml
EUR 1394

Mouse Neuromedin- U receptor 2, Nmur2 ELISA KIT
ELI-45724m 96 Tests
EUR 865

NMUR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV712785 1.0 ug DNA
EUR 316

NMUR2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV712789 1.0 ug DNA
EUR 316

NMUR2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV712790 1.0 ug DNA
EUR 316

Bovine Neuromedin- U receptor 2, NMUR2 ELISA KIT
ELI-39624b 96 Tests
EUR 928

Human Neuromedin- U receptor 2, NMUR2 ELISA KIT
ELI-39625h 96 Tests
EUR 824

NMUR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV695173 1.0 ug DNA
EUR 682

NMUR2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV695177 1.0 ug DNA
EUR 682

NMUR2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV695178 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

 

Scroll to Top