CD151 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

CD151 Polyclonal Antibody
ABP58035-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of CD151 from Human, Mouse, Rat. This CD151 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140

CD151 Polyclonal Antibody
ABP58035-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of CD151 from Human, Mouse, Rat. This CD151 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140

CD151 Polyclonal Antibody
ABP58035-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of CD151 from Human, Mouse, Rat. This CD151 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140

CD151 Polyclonal Antibody
46814-100ul 100ul
EUR 252

CD151 Polyclonal Antibody
46814-50ul 50ul
EUR 187

CD151 Rabbit pAb
A1930-100ul 100 ul
EUR 308

CD151 Rabbit pAb
A1930-200ul 200 ul
EUR 459

CD151 Rabbit pAb
A1930-20ul 20 ul
EUR 183

CD151 Rabbit pAb
A1930-50ul 50 ul
EUR 223

CD151 Antigen (CD151) Antibody
20-abx111462
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody
abx122519-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody
20-abx001576
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody
20-abx326895
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody
20-abx214915
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody
20-abx318194
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody
abx413443-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

CD151 Antigen (CD151) Antibody
abx413446-01mg 0.1 mg
EUR 439
  • Shipped within 1 week.

CD151 Antigen (CD151) Antibody
abx413449-25ug 25 ug
EUR 272
  • Shipped within 1 week.

CD151 Antigen (CD151) Antibody
20-abx242412
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody
20-abx225085
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody
abx231431-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CD151 Antigen (CD151) Antibody (HRP)
20-abx314776
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody (FITC)
20-abx314777
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody (Biotin)
20-abx314778
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD151 Antigen (CD151) Antibody (FITC)
abx413444-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

CD151 Antigen (CD151) Antibody (FITC)
abx413445-25ug 25 ug
EUR 272
  • Shipped within 1 week.

CD151 Antigen (CD151) Antibody (RPE)
abx413447-100tests 100 tests
EUR 592
  • Shipped within 1 week.

CD151 Antigen (CD151) Antibody (RPE)
abx413448-25tests 25 tests
EUR 314
  • Shipped within 1 week.

CD151 Antibody
abx140514-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

CD151 Antibody
ABD6699 100 ug
EUR 438

CD151 Antibody
32504-100ul 100ul
EUR 252

CD151 antibody
70R-16255 50 ul
EUR 435
Description: Rabbit polyclonal CD151 antibody

CD151 Antibody
DF6699 200ul
EUR 304
Description: CD151 Antibody detects endogenous levels of total CD151.

CD151 Antibody
1-CSB-PA940948
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

CD151 Antibody
1-CSB-PA004880GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CD151 Antibody
1-CSB-PA004880LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CD151 Antibody
1-CSB-PA151172
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:2000, IHC:1:10-1:50

CD151 Antibody
1-CSB-PA153822
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

CD151 antibody
PAab09920 100 ug
EUR 386

Rabbit CD151 ELISA Kit
ERTC0218 96Tests
EUR 521

anti- CD151 antibody
FNab01431 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: CD151 molecule (Raph blood group)
  • Uniprot ID: P48509
  • Gene ID: 977
  • Research Area: Stem Cells, Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against CD151

anti- CD151 antibody
FNab09920 100µg
EUR 548.75
  • Recommended dilution: WB: 1:2000-1:20000
  • IHC: 1:200-1:1000
  • Immunogen: CD151 molecule
  • Uniprot ID: P48509
  • Gene ID: 977
  • Research Area: Stem Cells, Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against CD151

CD151 Antibody (PE)
abx140520-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

Anti-CD151 Antibody
A02320-1 100ug/vial
EUR 334

Anti-CD151 antibody
PAab01431 100 ug
EUR 355

Anti-CD151 antibody
STJ98746 200 µl
EUR 197
Description: Rabbit polyclonal to CD151.

Anti-CD151 antibody
STJ22974 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It is involved in cellular processes including cell adhesion and may regulate integrin trafficking and/or function. This protein enhances cell motility, invasion and metastasis of cancer cells. Multiple alternatively spliced transcript variants that encode the same protein have been described for this gene.

Cd151/ Rat Cd151 ELISA Kit
ELI-33898r 96 Tests
EUR 886

Bovine CD151 antigen, CD151 ELISA KIT
ELI-25207b 96 Tests
EUR 928

Human CD151 antigen, CD151 ELISA KIT
ELI-33897h 96 Tests
EUR 824

Mouse CD151 antigen, Cd151 ELISA KIT
ELI-49935m 96 Tests
EUR 865

Human CD151 Antigen (CD151) ELISA Kit
abx386381-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse CD151 Antigen (CD151) ELISA Kit
abx388802-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat CD151 Antigen (CD151) ELISA Kit
abx391089-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

CD151 siRNA
20-abx900896
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD151 siRNA
20-abx910925
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD151 siRNA
20-abx910926
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-CD151
PVT18809 2 ug
EUR 231

CD151 Antibody, HRP conjugated
1-CSB-PA004880LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CD151 Antibody, FITC conjugated
1-CSB-PA004880LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CD151 Antibody, Biotin conjugated
1-CSB-PA004880LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cd151 ELISA Kit| Rat CD151 antigen ELISA Kit
EF018442 96 Tests
EUR 689

Cd151 ELISA Kit| Mouse CD151 antigen ELISA Kit
EF014427 96 Tests
EUR 689

CD151 cloning plasmid
CSB-CL004880HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atgggtgagttcaacgagaagaagacaacatgtggcaccgtttgcctcaagtacctgctgtttacctacaattgctgcttctggctggctggcctggctgtcatggcagtgggcatctggacgctggccctcaagagtgactacatcagcctgctggcctcaggcacctacctggc
  • Show more
Description: A cloning plasmid for the CD151 gene.

CD151 Blocking Peptide
DF6699-BP 1mg
EUR 195

Anti-CD151 (1B2)
YF-MA12355 100 ug
EUR 363
Description: Mouse monoclonal to CD151

Rat CD151 shRNA Plasmid
20-abx986204
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CD151 ELISA Kit
EHC0218 96Tests
EUR 521

Goat CD151 ELISA Kit
EGTC0218 96Tests
EUR 521

Canine CD151 ELISA Kit
ECC0218 96Tests
EUR 521

Chicken CD151 ELISA Kit
ECKC0218 96Tests
EUR 521

Bovine CD151 ELISA Kit
EBC0218 96Tests
EUR 521

Anserini CD151 ELISA Kit
EAC0218 96Tests
EUR 521

CD151 ELISA KIT|Human
EF008495 96 Tests
EUR 689

Porcine CD151 ELISA Kit
EPC0218 96Tests
EUR 521

Rat CD151 ELISA Kit
ERC0218 96Tests
EUR 521

Sheep CD151 ELISA Kit
ESC0218 96Tests
EUR 521

Mouse CD151 ELISA Kit
EMC0218 96Tests
EUR 521

Monkey CD151 ELISA Kit
EMKC0218 96Tests
EUR 521

Human CD151 shRNA Plasmid
20-abx950698
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-Hu CD151 PE
1P-149-T025 25 tests
EUR 140

Anti-Hu CD151 PE
1P-149-T100 100 tests
EUR 240

Anti-Hu CD151 Purified
11-149-C025 0.025 mg
EUR 99

Anti-Hu CD151 Purified
11-149-C100 0.1 mg
EUR 158

Mouse CD151 shRNA Plasmid
20-abx969545
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD151 Recombinant Protein (Human)
RP006271 100 ug Ask for price

CD151 Recombinant Protein (Rat)
RP193841 100 ug Ask for price

CD151 Recombinant Protein (Mouse)
RP122345 100 ug Ask for price

CD151 Recombinant Protein (Mouse)
RP122348 100 ug Ask for price

CD151 Recombinant Protein (Mouse)
RP122351 100 ug Ask for price

Mouse Anti Human Cd151 Monoclonal Antibody,RPE
CABT-47103MH 100 TEST
EUR 710

Guinea Pig CD151 ELISA Kit
EGC0218 96Tests
EUR 521

CD151 ORF Vector (Human) (pORF)
ORF002091 1.0 ug DNA
EUR 95

Cd151 ORF Vector (Mouse) (pORF)
ORF040783 1.0 ug DNA
EUR 506

Cd151 ORF Vector (Mouse) (pORF)
ORF040784 1.0 ug DNA
EUR 506

Cd151 ORF Vector (Mouse) (pORF)
ORF040785 1.0 ug DNA
EUR 506

Cd151 ORF Vector (Rat) (pORF)
ORF064615 1.0 ug DNA
EUR 506

CD151 ELISA Kit (Human) (OKCA01149)
OKCA01149 96 Wells
EUR 846
Description: Description of target: Essential for the proper assembly of the glomerular and tubular basement membranes in kidney.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.039 ng/mL

CD151 sgRNA CRISPR Lentivector set (Human)
K0405401 3 x 1.0 ug
EUR 339

Cd151 sgRNA CRISPR Lentivector set (Mouse)
K4390601 3 x 1.0 ug
EUR 339

Cd151 sgRNA CRISPR Lentivector set (Rat)
K6941101 3 x 1.0 ug
EUR 339

CD151 sgRNA CRISPR Lentivector (Human) (Target 1)
K0405402 1.0 ug DNA
EUR 154

CD151 sgRNA CRISPR Lentivector (Human) (Target 2)
K0405403 1.0 ug DNA
EUR 154

CD151 sgRNA CRISPR Lentivector (Human) (Target 3)
K0405404 1.0 ug DNA
EUR 154

Cd151 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4390602 1.0 ug DNA
EUR 154

Cd151 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4390603 1.0 ug DNA
EUR 154

Cd151 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4390604 1.0 ug DNA
EUR 154

Cd151 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6941102 1.0 ug DNA
EUR 154

Cd151 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6941103 1.0 ug DNA
EUR 154

Cd151 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6941104 1.0 ug DNA
EUR 154

CD151 Protein Vector (Human) (pPB-C-His)
PV008361 500 ng
EUR 329

CD151 Protein Vector (Human) (pPB-N-His)
PV008362 500 ng
EUR 329

CD151 Protein Vector (Human) (pPM-C-HA)
PV008363 500 ng
EUR 329

CD151 Protein Vector (Human) (pPM-C-His)
PV008364 500 ng
EUR 329

CD151 Protein Vector (Rat) (pPB-C-His)
PV258458 500 ng
EUR 603

CD151 Protein Vector (Rat) (pPB-N-His)
PV258459 500 ng
EUR 603

CD151 Protein Vector (Rat) (pPM-C-HA)
PV258460 500 ng
EUR 603

 

Scroll to Top