PNKP Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

PNKP Polyclonal Antibody
ABP59961-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of PNKP from Human. This PNKP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130

PNKP Polyclonal Antibody
ABP59961-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of PNKP from Human. This PNKP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKP protein at amino acid sequence of 50-130

PNKP Rabbit pAb
A6693-100ul 100 ul
EUR 308

PNKP Rabbit pAb
A6693-200ul 200 ul
EUR 459

PNKP Rabbit pAb
A6693-20ul 20 ul
EUR 183

PNKP Rabbit pAb
A6693-50ul 50 ul
EUR 223

PNKP antibody
70R-4477 50 ug
EUR 467
Description: Rabbit polyclonal PNKP antibody raised against the N terminal of PNKP

PNKP antibody
70R-4478 50 ug
EUR 467
Description: Rabbit polyclonal PNKP antibody raised against the middle region of PNKP

PNKP antibody
39107-100ul 100ul
EUR 252

PNKP Antibody
39908-100ul 100ul
EUR 390

PNKP Antibody
DF10318 200ul
EUR 304
Description: PNKP Antibody detects endogenous levels of PNKP.

PNKP (Phospho-Ser114) Polyclonal Conjugated Antibody
C12775 100ul
EUR 397

PNKP Conjugated Antibody
C39107 100ul
EUR 397

anti- PNKP antibody
FNab06583 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: polynucleotide kinase 3'-phosphatase
  • Uniprot ID: Q96T60
  • Gene ID: 11284
  • Research Area: Metabolism
Description: Antibody raised against PNKP

PNKP (pS114) Antibody
abx217835-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-PNKP antibody
PAab06583 100 ug
EUR 355

Anti-PNKP antibody
STJ28776 100 µl
EUR 277
Description: This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.

Anti-PNKP antibody
STJ190167 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PNKP

PNKP siRNA
20-abx929062
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PNKP
LF-PA10022 50 ul
EUR 334
Description: Mouse polyclonal to PNKP

Phospho-PNKP (Ser114) Antibody
AF8503 200ul
EUR 376
Description: PNKP (Phospho-Ser114) Antibody detects endogenous levels of PNKP only when phosphorylated at Ser114.

PNKP (Phospho- Ser114) Antibody
ABF8503 100 ug
EUR 438

PNKP (Phospho-Ser114) Antibody
12775-100ul 100ul
EUR 252

PNKP (Phospho-Ser114) Antibody
12775-50ul 50ul
EUR 187

Anti-PNKP / PNK antibody
STJ70208 100 µg
EUR 359

PNKP Blocking Peptide
33R-6026 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PNKP antibody, catalog no. 70R-4477

PNKP Blocking Peptide
33R-1356 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPCB antibody, catalog no. 20R-1314

PNKP cloning plasmid
CSB-CL857031HU1-10ug 10ug
EUR 548
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1566
  • Sequence: atgggcgaggtggaggccccgggccgcttgtggctcgagagcccccctgggggagcgccccccatcttcctgccctcggacgggcaagccctggtcctgggcaggggacccctgacccaggttacggaccggaagtgctccagaactcaagtggagctggtcgcagatcctgaga
  • Show more
Description: A cloning plasmid for the PNKP gene.

PNKP cloning plasmid
CSB-CL857031HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1449
  • Sequence: atgcaaatcctgactccacccctccaatcctcagtggagctggtcgcagatcctgagacccggacagtggcagtgaaacagctgggagttaacccctcaactaccgggacccaggagttgaagccggggttggagggctctctgggggtgggggacacactgtatttggtcaatg
  • Show more
Description: A cloning plasmid for the PNKP gene.

PNKP Blocking Peptide
DF10318-BP 1mg
EUR 195

PNKP ELISA KIT|Human
EF001895 96 Tests
EUR 689

Human PNKP ELISA KIT
ELI-37326h 96 Tests
EUR 824

Mouse Pnkp ELISA KIT
ELI-45543m 96 Tests
EUR 865

Human PNKP shRNA Plasmid
20-abx957739
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PNKP Recombinant Protein (Human)
RP023932 100 ug Ask for price

PNKP Recombinant Protein (Human)
RP023935 100 ug Ask for price

PNKP Recombinant Protein (Rat)
RP221165 100 ug Ask for price

PNKP Recombinant Protein (Mouse)
RP163121 100 ug Ask for price

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody
20-abx142149
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody
abx036773-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody
20-abx005133
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody
abx027808-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody
abx027808-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody
abx430284-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Bifunctional Polynucleotide Phosphatase/kinase (PNKP) Antibody
abx236583-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx111036
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx012964
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx325901
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx339818
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
abx331532-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
abx230484-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Aprataxin And PNKP Like Factor (APLF) Antibody
20-abx210495
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospho-PNKP (Ser114) Blocking Peptide
AF8503-BP 1mg
EUR 195

PNKP ORF Vector (Human) (pORF)
ORF007978 1.0 ug DNA
EUR 95

PNKP ORF Vector (Human) (pORF)
ORF007979 1.0 ug DNA
EUR 95

Pnkp ORF Vector (Rat) (pORF)
ORF073723 1.0 ug DNA
EUR 506

Pnkp ORF Vector (Mouse) (pORF)
ORF054375 1.0 ug DNA
EUR 506

PNKP sgRNA CRISPR Lentivector set (Human)
K1676001 3 x 1.0 ug
EUR 339

Human Bifunctional polynucleotide phosphatase/kinase (PNKP)
1-CSB-EP857031HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 73.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Bifunctional polynucleotide phosphatase/kinase(PNKP) expressed in E.coli

Pnkp sgRNA CRISPR Lentivector set (Rat)
K7470801 3 x 1.0 ug
EUR 339

Pnkp sgRNA CRISPR Lentivector set (Mouse)
K4958201 3 x 1.0 ug
EUR 339

PNKP sgRNA CRISPR Lentivector (Human) (Target 1)
K1676002 1.0 ug DNA
EUR 154

PNKP sgRNA CRISPR Lentivector (Human) (Target 2)
K1676003 1.0 ug DNA
EUR 154

PNKP sgRNA CRISPR Lentivector (Human) (Target 3)
K1676004 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Rat) (Target 1)
K7470802 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Rat) (Target 2)
K7470803 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Rat) (Target 3)
K7470804 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4958202 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4958203 1.0 ug DNA
EUR 154

Pnkp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4958204 1.0 ug DNA
EUR 154

PNKP Protein Vector (Human) (pPB-C-His)
PV031909 500 ng
EUR 329

PNKP Protein Vector (Human) (pPB-N-His)
PV031910 500 ng
EUR 329

PNKP Protein Vector (Human) (pPM-C-HA)
PV031911 500 ng
EUR 329

PNKP Protein Vector (Human) (pPM-C-His)
PV031912 500 ng
EUR 329

PNKP Protein Vector (Human) (pPB-C-His)
PV031913 500 ng
EUR 329

PNKP Protein Vector (Human) (pPB-N-His)
PV031914 500 ng
EUR 329

 

Scroll to Top