COL8A2 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

COL8A2 Polyclonal Antibody
ABP58228-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660
  • Applications tips:
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660

COL8A2 Polyclonal Antibody
ABP58228-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660
  • Applications tips:
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660

COL8A2 Polyclonal Antibody
ABP58228-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660
  • Applications tips:
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660

COL8A2 Polyclonal Antibody
46907-100ul 100ul
EUR 252

COL8A2 Polyclonal Antibody
46907-50ul 50ul
EUR 187

COL8A2 antibody
70R-9965 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal COL8A2 antibody

COL8A2 antibody
70R-9966 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal COL8A2 antibody

COL8A2 Antibody
43219-100ul 100ul
EUR 252

COL8A2 Antibody
1-CSB-PA554584
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

COL8A2 Antibody
1-CSB-PA295305
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

COL8A2 Antibody
1-CSB-PA068096
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

COL8A2 Conjugated Antibody
C43219 100ul
EUR 397

Anti-COL8A2 antibody
STJ99330 200 µl
EUR 197
Description: Rabbit polyclonal to COL8A2.

COL8A2 siRNA
20-abx912461
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COL8A2 siRNA
20-abx912462
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COL8A2 cloning plasmid
CSB-CL005756HU-10ug 10ug
EUR 469
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1284
  • Sequence: ATGCTGGGGACTCTGACACCCCTGTCTTCGCTGCTGCTGCTGCTACTGGTGCTGGTGCTGGGGTGTGGGCCGCGGGCGTCCTCTGGTGGCGGGGCCGGTGGGGCGGCGGGCTATGCCCCAGTGAAGTACATCCAGCCCATGCAGAAAGGACCTGTGGGACCGCCCTTCCGTGAGG
  • Show more
Description: A cloning plasmid for the COL8A2 gene.

COL8A2 Blocking Peptide
33R-3463 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COL8A2 antibody, catalog no. 70R-9965

COL8A2 Blocking Peptide
33R-1023 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPBAP1 antibody, catalog no. 70R-8373

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human)
4-PAD124Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2)

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse)
4-PAD124Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2)

Mouse COL8A2 shRNA Plasmid
20-abx983586
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human COL8A2 shRNA Plasmid
20-abx950910
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

COL8A2 Recombinant Protein (Human)
RP038221 100 ug Ask for price

COL8A2 Recombinant Protein (Mouse)
RP125396 100 ug Ask for price

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), APC
4-PAD124Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), Biotinylated
4-PAD124Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Biotin.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), Cy3
4-PAD124Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Cy3.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), FITC
4-PAD124Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with FITC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), HRP
4-PAD124Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with HRP.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), PE
4-PAD124Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with PE.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), APC
4-PAD124Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), Biotinylated
4-PAD124Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Biotin.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), Cy3
4-PAD124Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Cy3.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), FITC
4-PAD124Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with FITC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), HRP
4-PAD124Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with HRP.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), PE
4-PAD124Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with PE.

Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit
E04C1922-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit
E04C1922-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit
E04C1922-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), APC-Cy7
4-PAD124Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC-Cy7.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAD124Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC-Cy7.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
20-abx149457
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8a2) Antibody
20-abx102836
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Collagen Type VIII Alpha 2 (COL8a2) Antibody
20-abx102837
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
abx026478-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
abx026478-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
20-abx329804
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
20-abx212740
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
20-abx212741
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Col8a2 ORF Vector (Mouse) (pORF)
ORF041800 1.0 ug DNA
EUR 506

COL8A2 ORF Vector (Human) (pORF)
ORF012741 1.0 ug DNA
EUR 354

pcDNA3.1-COL8A2-V5-His Plasmid
PVTB01199-2a 2 ug
EUR 356

COL8A2 ELISA Kit (Human) (OKCA01164)
OKCA01164 96 Wells
EUR 846
Description: Description of target: Macromolecular component of the subendothelium. Major component of the Descemet's membrane (basement membrane) of corneal endothelial cells. Also component of the endothelia of blood vessels. Necessary for migration and proliferation of vascular smooth muscle cells and thus, has a potential role in the maintenance of vessel wall integrity and structure, in particular in atherogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL

Collagen Type VIII Alpha 2 (COL8a2) Antibody (Biotin)
20-abx272547
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Collagen Type VIII Alpha 2 (COL8a2) Antibody (Biotin)
20-abx273004
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

COL8A2 sgRNA CRISPR Lentivector set (Human)
K0483901 3 x 1.0 ug
EUR 339

Col8a2 sgRNA CRISPR Lentivector set (Mouse)
K4173501 3 x 1.0 ug
EUR 339

COL8A2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0483902 1.0 ug DNA
EUR 154

COL8A2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0483903 1.0 ug DNA
EUR 154

COL8A2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0483904 1.0 ug DNA
EUR 154

Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4173502 1.0 ug DNA
EUR 154

Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4173503 1.0 ug DNA
EUR 154

Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4173504 1.0 ug DNA
EUR 154

COL8A2 Protein Vector (Human) (pPB-C-His)
PV050961 500 ng
EUR 481

COL8A2 Protein Vector (Human) (pPB-N-His)
PV050962 500 ng
EUR 481

COL8A2 Protein Vector (Human) (pPM-C-HA)
PV050963 500 ng
EUR 481

COL8A2 Protein Vector (Human) (pPM-C-His)
PV050964 500 ng
EUR 481

Recombinant Collagen Type VIII Alpha 2 (COL8a2)
4-RPD124Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P25067
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 6.4
Description: Recombinant Human Collagen Type VIII Alpha 2 expressed in: E.coli

Recombinant Collagen Type VIII Alpha 2 (COL8a2)
4-RPD124Mu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P25318
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Collagen Type VIII Alpha 2 expressed in: E.coli

COL8A2 Protein Vector (Mouse) (pPB-C-His)
PV167198 500 ng
EUR 1065

COL8A2 Protein Vector (Mouse) (pPB-N-His)
PV167199 500 ng
EUR 1065

COL8A2 Protein Vector (Mouse) (pPM-C-HA)
PV167200 500 ng
EUR 1065

COL8A2 Protein Vector (Mouse) (pPM-C-His)
PV167201 500 ng
EUR 1065

Col8a2 3'UTR Luciferase Stable Cell Line
TU202635 1.0 ml Ask for price

Col8a2 3'UTR GFP Stable Cell Line
TU154199 1.0 ml Ask for price

COL8A2 3'UTR Luciferase Stable Cell Line
TU004777 1.0 ml
EUR 1521

Col8a2 3'UTR Luciferase Stable Cell Line
TU104199 1.0 ml Ask for price

COL8A2 3'UTR GFP Stable Cell Line
TU054777 1.0 ml
EUR 1521

Col8a2 3'UTR GFP Stable Cell Line
TU252635 1.0 ml Ask for price

Human Collagen Type VIII Alpha 2 (COL8a2) Protein
20-abx066017
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Collagen Type VIII Alpha 2 (COL8a2) Protein
20-abx066018
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

 

Scroll to Top