COL8A2 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

COL8A2 Polyclonal Antibody
ABP58228-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660 Applications tips:
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660

COL8A2 Polyclonal Antibody
ABP58228-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660 Applications tips:
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660

COL8A2 Polyclonal Antibody
ABP58228-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660 Applications tips:
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660

COL8A2 Polyclonal Antibody
ES8857-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against COL8A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

COL8A2 Polyclonal Antibody
ES8857-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against COL8A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

COL8A2 Antibody
43219-100ul	SAB	100ul	EUR 252

COL8A2 Antibody
1-CSB-PA068096	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

COL8A2 Antibody
1-CSB-PA554584	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

COL8A2 Antibody
1-CSB-PA295305	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

COL8A2 antibody
70R-9965	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal COL8A2 antibody

COL8A2 antibody
70R-9966	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal COL8A2 antibody

COL8A2 Conjugated Antibody
C43219	SAB	100ul	EUR 397

Anti-COL8A2 antibody
STJ99330	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to COL8A2.

COL8A2 siRNA
20-abx912461	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

COL8A2 siRNA
20-abx912462	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

COL8A2 Blocking Peptide
33R-3463	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COL8A2 antibody, catalog no. 70R-9965

COL8A2 Blocking Peptide
33R-1023	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPBAP1 antibody, catalog no. 70R-8373

COL8A2 cloning plasmid
CSB-CL005756HU-10ug	Cusabio	10ug	EUR 469
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1284 Sequence: ATGCTGGGGACTCTGACACCCCTGTCTTCGCTGCTGCTGCTGCTACTGGTGCTGGTGCTGGGGTGTGGGCCGCGGGCGTCCTCTGGTGGCGGGGCCGGTGGGGCGGCGGGCTATGCCCCAGTGAAGTACATCCAGCCCATGCAGAAAGGACCTGTGGGACCGCCCTTCCGTGAGG Show more
Description: A cloning plasmid for the COL8A2 gene.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse)
4-PAD124Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp533~Pro698) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2)

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human)
4-PAD124Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp537~Thr703) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2)

Mouse COL8A2 shRNA Plasmid
20-abx983586	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human COL8A2 shRNA Plasmid
20-abx950910	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

COL8A2 Recombinant Protein (Human)
RP038221	ABM	100 ug	Ask for price

COL8A2 Recombinant Protein (Mouse)
RP125396	ABM	100 ug	Ask for price

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), Biotinylated
4-PAD124Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp537~Thr703) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Biotin.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), Cy3
4-PAD124Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp537~Thr703) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Cy3.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), FITC
4-PAD124Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp537~Thr703) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with FITC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), HRP
4-PAD124Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp537~Thr703) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with HRP.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), PE
4-PAD124Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp537~Thr703) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with PE.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), APC
4-PAD124Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp533~Pro698) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), Biotinylated
4-PAD124Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp533~Pro698) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Biotin.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), Cy3
4-PAD124Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp533~Pro698) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Cy3.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), FITC
4-PAD124Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp533~Pro698) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with FITC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), HRP
4-PAD124Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp533~Pro698) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with HRP.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), PE
4-PAD124Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp533~Pro698) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with PE.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), APC
4-PAD124Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp537~Thr703) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC.

Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit
E04C1922-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit
E04C1922-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit
E04C1922-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAD124Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp533~Pro698) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC-Cy7.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), APC-Cy7
4-PAD124Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: COL8a2 (Asp537~Thr703) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC-Cy7.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
abx026478-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
abx026478-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
20-abx212740	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
20-abx212741	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8a2) Antibody
20-abx102836	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Collagen Type VIII Alpha 2 (COL8a2) Antibody
20-abx102837	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
20-abx149457	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody
20-abx329804	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

COL8A2 ORF Vector (Human) (pORF)
ORF012741	ABM	1.0 ug DNA	EUR 354

Col8a2 ORF Vector (Mouse) (pORF)
ORF041800	ABM	1.0 ug DNA	EUR 506

pcDNA3.1-COL8A2-V5-His Plasmid
PVTB01199-2a	Lifescience Market	2 ug	EUR 356

COL8A2 ELISA Kit (Human) (OKCA01164)
OKCA01164	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Macromolecular component of the subendothelium. Major component of the Descemet's membrane (basement membrane) of corneal endothelial cells. Also component of the endothelia of blood vessels. Necessary for migration and proliferation of vascular smooth muscle cells and thus, has a potential role in the maintenance of vessel wall integrity and structure, in particular in atherogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL

Collagen Type VIII Alpha 2 (COL8a2) Antibody (Biotin)
20-abx272547	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Collagen Type VIII Alpha 2 (COL8a2) Antibody (Biotin)
20-abx273004	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

COL8A2 sgRNA CRISPR Lentivector set (Human)
K0483901	ABM	3 x 1.0 ug	EUR 339

Col8a2 sgRNA CRISPR Lentivector set (Mouse)
K4173501	ABM	3 x 1.0 ug	EUR 339

COL8A2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0483902	ABM	1.0 ug DNA	EUR 154

COL8A2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0483903	ABM	1.0 ug DNA	EUR 154

COL8A2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0483904	ABM	1.0 ug DNA	EUR 154

Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4173502	ABM	1.0 ug DNA	EUR 154

Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4173503	ABM	1.0 ug DNA	EUR 154

Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4173504	ABM	1.0 ug DNA	EUR 154

COL8A2 Protein Vector (Mouse) (pPB-C-His)
PV167198	ABM	500 ng	EUR 1065

COL8A2 Protein Vector (Mouse) (pPB-N-His)
PV167199	ABM	500 ng	EUR 1065

COL8A2 Protein Vector (Mouse) (pPM-C-HA)
PV167200	ABM	500 ng	EUR 1065

COL8A2 Protein Vector (Mouse) (pPM-C-His)
PV167201	ABM	500 ng	EUR 1065

COL8A2 Protein Vector (Human) (pPB-C-His)
PV050961	ABM	500 ng	EUR 481

COL8A2 Protein Vector (Human) (pPB-N-His)
PV050962	ABM	500 ng	EUR 481

COL8A2 Protein Vector (Human) (pPM-C-HA)
PV050963	ABM	500 ng	EUR 481

COL8A2 Protein Vector (Human) (pPM-C-His)
PV050964	ABM	500 ng	EUR 481

Recombinant Collagen Type VIII Alpha 2 (COL8a2)
4-RPD124Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P25067 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.4kDa Isoelectric Point: 6.4
Description: Recombinant Human Collagen Type VIII Alpha 2 expressed in: E.coli

Recombinant Collagen Type VIII Alpha 2 (COL8a2)
4-RPD124Mu01	Cloud-Clone	EUR 492.45 EUR 235.00 EUR 1571.68 EUR 590.56 EUR 1081.12 EUR 392.00 EUR 3779.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P25318 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Collagen Type VIII Alpha 2 expressed in: E.coli

Col8a2 3'UTR GFP Stable Cell Line
TU154199	ABM	1.0 ml	Ask for price

Col8a2 3'UTR Luciferase Stable Cell Line
TU104199	ABM	1.0 ml	Ask for price

Col8a2 3'UTR Luciferase Stable Cell Line
TU202635	ABM	1.0 ml	Ask for price

Col8a2 3'UTR GFP Stable Cell Line
TU252635	ABM	1.0 ml	Ask for price

COL8A2 3'UTR GFP Stable Cell Line
TU054777	ABM	1.0 ml	EUR 1521

COL8A2 3'UTR Luciferase Stable Cell Line
TU004777	ABM	1.0 ml	EUR 1521

Human Collagen Type VIII Alpha 2 (COL8a2) Protein
20-abx066017	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Collagen Type VIII Alpha 2 (COL8a2) Protein
20-abx066018	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products