VHL Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

VHL Polyclonal Antibody
ABP60891-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50 Applications tips:
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50

VHL Polyclonal Antibody
ABP60891-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50 Applications tips:
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50

VHL Polyclonal Antibody
ABP60891-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50 Applications tips:
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50

VHL Polyclonal Antibody
ABP56500-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68 Applications tips:
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68

VHL Polyclonal Antibody
ABP56500-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68 Applications tips:
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68

VHL Polyclonal Antibody
ABP56500-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68 Applications tips:
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68

VHL Polyclonal Antibody
ES7499-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VHL from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL Polyclonal Antibody
ES7499-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VHL from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL Polyclonal Antibody
ES8746-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VHL from Human. This antibody is tested and validated for IHC, WB, ELISA

VHL Polyclonal Antibody
ES8746-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VHL from Human. This antibody is tested and validated for IHC, WB, ELISA

VHL Rabbit pAb
A11240-100ul	Abclonal	100 ul	EUR 308

VHL Rabbit pAb
A11240-200ul	Abclonal	200 ul	EUR 459

VHL Rabbit pAb
A11240-20ul	Abclonal	20 ul	EUR 183

VHL Rabbit pAb
A11240-50ul	Abclonal	50 ul	EUR 223

VHL Rabbit pAb
A16287-100ul	Abclonal	100 ul	EUR 308

VHL Rabbit pAb
A16287-200ul	Abclonal	200 ul	EUR 459

VHL Rabbit pAb
A16287-20ul	Abclonal	20 ul	EUR 183

VHL Rabbit pAb
A16287-50ul	Abclonal	50 ul	EUR 223

VHL Rabbit pAb
A0377-100ul	Abclonal	100 ul	EUR 308

VHL Rabbit pAb
A0377-200ul	Abclonal	200 ul	EUR 459

VHL Rabbit pAb
A0377-20ul	Abclonal	20 ul	EUR 183

VHL Rabbit pAb
A0377-50ul	Abclonal	50 ul	EUR 223

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
DLR-vHL-Hu-48T	DL Develop	48T	EUR 549
Should the Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Hippel Lindau Tumor Suppressor (vHL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
DLR-vHL-Hu-96T	DL Develop	96T	EUR 718
Should the Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Hippel Lindau Tumor Suppressor (vHL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
DLR-vHL-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids.

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
DLR-vHL-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids.

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
RDR-vHL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 583

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
RDR-vHL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
RDR-vHL-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
RDR-vHL-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
RD-vHL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 557

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
RD-vHL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 775

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
RD-vHL-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit
RD-vHL-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Polyclonal VHL Antibody (C-term)
APR10723G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VHL (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-VHL Antibody
AMM05157G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VHL . This antibody is tested and proven to work in the following applications:

VHL (phospho Ser68) Polyclonal Antibody
ABP56499-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68 Applications tips:
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68

VHL (phospho Ser68) Polyclonal Antibody
ABP56499-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68 Applications tips:
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68

VHL (phospho Ser68) Polyclonal Antibody
ABP56499-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68 Applications tips:
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68

VHL (phospho Ser68) Polyclonal Antibody
ES7498-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VHL (phospho Ser68) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL (phospho Ser68) Polyclonal Antibody
ES7498-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VHL (phospho Ser68) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL Antibody
32075-100ul	SAB	100ul	EUR 252

VHL antibody
10R-1029	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal VHL antibody

VHL Antibody
1-CSB-PA060067	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

VHL Antibody
1-CSB-PA071125	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

VHL Antibody
1-CSB-PA991849	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

VHL Antibody
1-CSB-PA876839	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

VHL Antibody
DF6104	Affbiotech	200ul	EUR 304
Description: VHL Antibody detects endogenous levels of total VHL.

VHL Antibody
CSB-PA025852KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VHL Antibody
CSB-PA025852KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VHL antibody
70R-9757	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal VHL antibody

VHL antibody
70R-34605	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal VHL antibody

VHL Antibody
AF6292	Affbiotech	200ul	EUR 304
Description: VHL Antibody detects endogenous levels of total VHL.

VHL Antibody
ABF6292	Lifescience Market	100 ug	EUR 438

VHL Antibody
ABD6104	Lifescience Market	100 ug	EUR 438

VHL (Phospho-Ser68) Polyclonal Conjugated Antibody
C12654	SAB	100ul	EUR 397

Human VHL Antibody
32825-05111	AssayPro	150 ug	EUR 261

VHL (pS68) Antibody
abx219320-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

VHL Conjugated Antibody
C32075	SAB	100ul	EUR 397

anti- VHL antibody
FNab09402	FN Test	100µg	EUR 548.75
Recommended dilution: IF: 1:10-1:100 IHC: 1:20-1:200 Immunogen: von Hippel-Lindau tumor suppressor Uniprot ID: P40337 Gene ID: 7428 Research Area: Cancer, Metabolism
Description: Antibody raised against VHL

anti- VHL antibody
FNab10175	FN Test	100µg	EUR 505.25
Recommended dilution: IHC: 1:50-1:500 Immunogen: Histone-lysine N-methyltransferase EZH2 Uniprot ID: P40337 Gene ID: 7428
Description: Antibody raised against VHL

Anti-VHL antibody
PAab09402	Lifescience Market	100 ug	EUR 386

Anti-VHL antibody
STJ26089	St John's Laboratory	100 µl	EUR 277
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-VHL antibody
STJ113440	St John's Laboratory	50 µl	EUR 277
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-VHL antibody
STJ113742	St John's Laboratory	100 µl	EUR 277
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-VHL antibody
STJ118733	St John's Laboratory	100 µl	EUR 277

Anti-VHL antibody
STJ96241	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to VHL.

Anti-VHL antibody
STJ70964	St John's Laboratory	100 µg	EUR 359

Anti-VHL Antibody
STJ502735	St John's Laboratory	100 µg	EUR 476

Anti-VHL antibody
STJ98809	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to VHL.

VHL/ Rat VHL ELISA Kit
ELA-E1894r	Lifescience Market	96 Tests	EUR 886

Vhl/ Rat Vhl ELISA Kit
ELI-06080r	Lifescience Market	96 Tests	EUR 886

VHL siRNA
20-abx906024	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VHL siRNA
20-abx939411	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VHL siRNA
20-abx939412	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VHL (Phospho-Ser68) Antibody
12654-100ul	SAB	100ul	EUR 252

VHL (Phospho-Ser68) Antibody
12654-50ul	SAB	50ul	EUR 187

Phospho-VHL (S68) Antibody
1-CSB-PA060066	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-VHL (S68). Recognizes Phospho-VHL (S68) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Phospho-VHL (Ser68) Antibody
AF8334	Affbiotech	200ul	EUR 376
Description: VHL (Phospho-Ser68) Antibody detects endogenous levels of VHL only when phosphorylated at Ser68.

VHL (Phospho- Ser68) Antibody
ABF8334	Lifescience Market	100 ug	EUR 438

Anti-VHL, Biotinylated antibody
STJ73173	St John's Laboratory	100 µg	EUR 359

Anti-VHL Antibody (Biotin)
STJ502736	St John's Laboratory	100 µg	EUR 586

Anti-VHL Antibody (FITC)
STJ502737	St John's Laboratory	100 µg	EUR 586

Polyclonal VHL / Von Hippel Lindau Antibody (aa34-83)
APR10721G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VHL / Von Hippel Lindau (aa34-83). This antibody is tested and proven to work in the following applications:

VHL Mouse mAb
A11872-100ul	Abclonal	100 ul	Ask for price

VHL Mouse mAb
A11872-200ul	Abclonal	200 ul	Ask for price

VHL Mouse mAb
A11872-20ul	Abclonal	20 ul	Ask for price

VHL Mouse mAb
A11872-50ul	Abclonal	50 ul	EUR 265

VHL Blocking Peptide
33R-2312	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VHL antibody, catalog no. 70R-9757

VHL Blocking Peptide
DF6104-BP	Affbiotech	1mg	EUR 195

VHL Blocking Peptide
AF6292-BP	Affbiotech	1mg	EUR 195

VHL cloning plasmid
CSB-CL025852HU-10ug	Cusabio	10ug	EUR 255
Formulation: 10 μg plasmid + 200μl Glycerol Length: 519 Sequence: atgccccggagggcggagaactgggacgaggccgaggtaggcgcggaggaggcaggcgtcgaagagtacggccctgaagaagacggcggggaggagtcgggcgccgaggagtccggcccggaagagtccggcccggaggaactgggcgccgaggaggagatggaggccgggcggcc Show more
Description: A cloning plasmid for the VHL gene.

Recombinant human VHL
P2120	FN Test	100ug	Ask for price
Uniprot ID: P40337 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human VHL

Human VHL Antibody (Biotin Conjugate)
32825-05121	AssayPro	150 ug	EUR 369

Anti-Phospho-VHL (S68) antibody
STJ91273	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Phospho-VHL (S68).

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat)
4-PAJ769Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: vHL (Ala6~Gln175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL)

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), APC
4-PAJ769Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: vHL (Ala6~Gln175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with APC.

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), Biotinylated
4-PAJ769Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: vHL (Ala6~Gln175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with Biotin.