VSX2 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

VSX2 Polyclonal Antibody

ES9043-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VSX2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VSX2 Antibody

45508-100ul 100ul
EUR 252

VSX2 Antibody

45508-50ul 50ul
EUR 187

VSX2 Antibody

DF8805 200ul
EUR 304
Description: VSX2 Antibody detects endogenous levels of total VSX2.

VSX2 Antibody

ABD13316 100 ug
EUR 438

VSX2 Antibody

ABD8805 100 ug
EUR 438

VSX2 Conjugated Antibody

C45508 100ul
EUR 397

anti- VSX2 antibody

FNab09459 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: visual system homeobox 2
  • Uniprot ID: P58304
  • Gene ID: 338917
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against VSX2

Anti-VSX2 antibody

PAab09459 100 ug
EUR 412

Anti-VSX2 antibody

STJ190201 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VSX2

VSX2 siRNA

20-abx939585
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VSX2 siRNA

20-abx939586
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-CHX10/VSX2 Antibody

A05180 100ug/vial
EUR 294

VSX2 Blocking Peptide

DF8805-BP 1mg
EUR 195

VSX2 cloning plasmid

CSB-CL025939HU-10ug 10ug
EUR 413
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1086
  • Sequence: ATGACGGGGAAAGCAGGGGAAGCGCTGAGCAAGCCCAAATCCGAGACAGTGGCCAAGAGTACCTCGGGGGGCGCCCCGGCCAGGTGCACTGGGTTCGGCATCCAGGAGATCCTGGGCTTGAACAAGGAGCCCCCGAGCTCCCACCCGCGGGCAGCGCTCGACGGCCTGGCCCCCG
  • Show more
Description: A cloning plasmid for the VSX2 gene.

Rabbit Visual system homeobox 2(VSX2) ELISA kit

E04V0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Visual system homeobox 2(VSX2) ELISA kit

E04V0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Visual system homeobox 2(VSX2) ELISA kit

E04V0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

VSX2 ELISA KIT|Human

EF004239 96 Tests
EUR 689

Human VSX2 shRNA Plasmid

20-abx967263
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse VSX2 shRNA Plasmid

20-abx969675
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VSX2 Recombinant Protein (Rat)

RP237104 100 ug Ask for price

VSX2 Recombinant Protein (Human)

RP044800 100 ug Ask for price

VSX2 Recombinant Protein (Mouse)

RP185030 100 ug Ask for price

Visual System Homeobox 2 (VSX2) Antibody

20-abx219339
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Visual System Homeobox 2 (VSX2) Antibody

abx239459-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Vsx2 ORF Vector (Mouse) (pORF)

ORF061678 1.0 ug DNA
EUR 506

Vsx2 ORF Vector (Rat) (pORF)

ORF079036 1.0 ug DNA
EUR 506

VSX2 ORF Vector (Human) (pORF)

ORF014934 1.0 ug DNA
EUR 354

Visual System Homeobox Protein 2 (VSX2) Antibody (Biotin)

20-abx272574
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Visual System Homeobox Protein 2 (VSX2) Antibody (Biotin)

20-abx273030
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Visual System Homeobox Protein 2 (VSX2) Antibody (Biotin)

20-abx273432
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Vsx2 sgRNA CRISPR Lentivector set (Rat)

K6986701 3 x 1.0 ug
EUR 339

VSX2 sgRNA CRISPR Lentivector set (Human)

K2621901 3 x 1.0 ug
EUR 339

Vsx2 sgRNA CRISPR Lentivector set (Mouse)

K4747601 3 x 1.0 ug
EUR 339

Vsx2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6986702 1.0 ug DNA
EUR 154

Vsx2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6986703 1.0 ug DNA
EUR 154

Vsx2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6986704 1.0 ug DNA
EUR 154

VSX2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2621902 1.0 ug DNA
EUR 154

VSX2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2621903 1.0 ug DNA
EUR 154

VSX2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2621904 1.0 ug DNA
EUR 154

Vsx2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4747602 1.0 ug DNA
EUR 154

Vsx2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4747603 1.0 ug DNA
EUR 154

Vsx2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4747604 1.0 ug DNA
EUR 154

VSX2 Protein Vector (Mouse) (pPB-C-His)

PV246710 500 ng
EUR 603

VSX2 Protein Vector (Mouse) (pPB-N-His)

PV246711 500 ng
EUR 603

VSX2 Protein Vector (Mouse) (pPM-C-HA)

PV246712 500 ng
EUR 603

VSX2 Protein Vector (Mouse) (pPM-C-His)

PV246713 500 ng
EUR 603

VSX2 Protein Vector (Rat) (pPB-C-His)

PV316142 500 ng
EUR 603

VSX2 Protein Vector (Rat) (pPB-N-His)

PV316143 500 ng
EUR 603

VSX2 Protein Vector (Rat) (pPM-C-HA)

PV316144 500 ng
EUR 603

VSX2 Protein Vector (Rat) (pPM-C-His)

PV316145 500 ng
EUR 603

VSX2 Protein Vector (Human) (pPB-C-His)

PV059733 500 ng
EUR 481

VSX2 Protein Vector (Human) (pPB-N-His)

PV059734 500 ng
EUR 481

VSX2 Protein Vector (Human) (pPM-C-HA)

PV059735 500 ng
EUR 481

VSX2 Protein Vector (Human) (pPM-C-His)

PV059736 500 ng
EUR 481

Vsx2 3'UTR Luciferase Stable Cell Line

TU122161 1.0 ml Ask for price

VSX2 3'UTR GFP Stable Cell Line

TU078326 1.0 ml
EUR 1521

Vsx2 3'UTR GFP Stable Cell Line

TU172161 1.0 ml Ask for price

Vsx2 3'UTR Luciferase Stable Cell Line

TU223283 1.0 ml Ask for price

VSX2 3'UTR Luciferase Stable Cell Line

TU028326 1.0 ml
EUR 1521

Vsx2 3'UTR GFP Stable Cell Line

TU273283 1.0 ml Ask for price

Rat Visual system homeobox 2(VSX2) ELISA kit

E02V0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Visual system homeobox 2(VSX2) ELISA kit

E02V0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Visual system homeobox 2(VSX2) ELISA kit

E02V0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Visual system homeobox 2(VSX2) ELISA kit

E03V0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Visual system homeobox 2(VSX2) ELISA kit

E03V0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Visual system homeobox 2(VSX2) ELISA kit

E03V0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visual system homeobox 2(VSX2) ELISA kit

E01V0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visual system homeobox 2(VSX2) ELISA kit

E01V0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visual system homeobox 2(VSX2) ELISA kit

E01V0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Visual system homeobox 2(VSX2) ELISA kit

E08V0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Visual system homeobox 2(VSX2) ELISA kit

E08V0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Visual system homeobox 2(VSX2) ELISA kit

E08V0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Visual system homeobox 2(VSX2) ELISA kit

E06V0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Visual system homeobox 2(VSX2) ELISA kit

E06V0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Visual system homeobox 2(VSX2) ELISA kit

E06V0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Visual system homeobox 2(VSX2) ELISA kit

E07V0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Visual system homeobox 2(VSX2) ELISA kit

E07V0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Visual system homeobox 2(VSX2) ELISA kit

E07V0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Visual system homeobox 2(VSX2) ELISA kit

E09V0078-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Visual system homeobox 2(VSX2) ELISA kit

E09V0078-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Visual system homeobox 2(VSX2) ELISA kit

E09V0078-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Visual system homeobox 2(VSX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Visual system homeobox 2, Vsx2 ELISA KIT

ELI-51409m 96 Tests
EUR 865

Human Visual system homeobox 2 (VSX2) ELISA Kit

abx384264-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Visual system homeobox 2, VSX2 ELISA KIT

ELI-35281h 96 Tests
EUR 824

Chicken Visual system homeobox 2, VSX2 ELISA KIT

ELI-40232c 96 Tests
EUR 928

VSX2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV625903 1.0 ug DNA
EUR 682

VSX2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV625907 1.0 ug DNA
EUR 682

VSX2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV625908 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

 

Scroll to Top