NR2C1 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

NR2C1 Polyclonal Antibody
ES9035-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NR2C1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR2C1 Polyclonal Antibody
ES9035-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NR2C1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR2C1 Rabbit pAb
A6675-100ul 100 ul
EUR 308

NR2C1 Rabbit pAb
A6675-200ul 200 ul
EUR 459

NR2C1 Rabbit pAb
A6675-20ul 20 ul
EUR 183

NR2C1 Rabbit pAb
A6675-50ul 50 ul
EUR 223

NR2C1 Polyclonal Conjugated Antibody
C42274 100ul
EUR 397

NR2C1 antibody
20R-2871 100 ul
EUR 349
Description: Rabbit polyclonal NR2C1 antibody

NR2C1 antibody
70R-18952 50 ul
EUR 435
Description: Rabbit polyclonal NR2C1 antibody

NR2C1 antibody
10R-1525 100 ug
EUR 512
Description: Mouse monoclonal NR2C1 antibody

NR2C1 Antibody
DF8785 200ul
EUR 304
Description: NR2C1 Antibody detects endogenous levels of total NR2C1.

NR2C1 Antibody
1-CSB-PA016051ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

NR2C1 Antibody
1-CSB-PA016051ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NR2C1 Antibody
1-CSB-PA016051GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NR2C1 Antibody
ABD8785 100 ug
EUR 438

Nr2c1/ Rat Nr2c1 ELISA Kit
ELI-46138r 96 Tests
EUR 886

anti- NR2C1 antibody
FNab05840 100µg
EUR 505.25
  • Immunogen: nuclear receptor subfamily 2, group C, member 1
  • Uniprot ID: P13056
  • Gene ID: 7181
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against NR2C1

Anti-NR2C1 antibody
PAab05840 100 ug
EUR 355

Anti-NR2C1 antibody
STJ28758 100 µl
EUR 277
Description: This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined.

Anti-NR2C1 antibody
STJ190193 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR2C1

NR2C1 siRNA
20-abx903646
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR2C1 siRNA
20-abx926331
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR2C1 siRNA
20-abx926332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR2C1 Blocking Peptide
DF8785-BP 1mg
EUR 195

NR2C1 cloning plasmid
CSB-CL016051HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1404
  • Sequence: atggcaaccatagaagaaattgcacatcaaattattgaacaacagatgggagagattgttacagagcagcaaactgggcagaaaatccagattgtgacagcacttgatcataatacccaaggcaagcagttcattctgacaaatcacgacggctctactccaagcaaagtcattc
  • Show more
Description: A cloning plasmid for the NR2C1 gene.

Human NR2C1 ELISA KIT
ELI-13315h 96 Tests
EUR 824

Mouse Nr2c1 ELISA KIT
ELI-21287m 96 Tests
EUR 865

NR2C1 ELISA KIT|Human
EF001316 96 Tests
EUR 689

Bovine NR2C1 ELISA KIT
ELI-46137b 96 Tests
EUR 928

Rat NR2C1 shRNA Plasmid
20-abx988029
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NR2C1 shRNA Plasmid
20-abx973202
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NR2C1 shRNA Plasmid
20-abx954931
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NR2C1 Recombinant Protein (Human)
RP021604 100 ug Ask for price

NR2C1 Recombinant Protein (Mouse)
RP154889 100 ug Ask for price

NR2C1 Recombinant Protein (Rat)
RP214454 100 ug Ask for price

Nr2c1 ORF Vector (Rat) (pORF)
ORF071486 1.0 ug DNA
EUR 506

NR2C1 ORF Vector (Human) (pORF)
ORF007202 1.0 ug DNA
EUR 95

Nr2c1 ORF Vector (Mouse) (pORF)
ORF051631 1.0 ug DNA
EUR 506

Nr2c1 sgRNA CRISPR Lentivector set (Rat)
K7368101 3 x 1.0 ug
EUR 339

Nr2c1 sgRNA CRISPR Lentivector set (Mouse)
K3814201 3 x 1.0 ug
EUR 339

NR2C1 sgRNA CRISPR Lentivector set (Human)
K1452101 3 x 1.0 ug
EUR 339

Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7368102 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7368103 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7368104 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3814202 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3814203 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3814204 1.0 ug DNA
EUR 154

NR2C1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1452102 1.0 ug DNA
EUR 154

NR2C1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1452103 1.0 ug DNA
EUR 154

NR2C1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1452104 1.0 ug DNA
EUR 154

NR2C1 Protein Vector (Rat) (pPB-C-His)
PV285942 500 ng
EUR 603

NR2C1 Protein Vector (Rat) (pPB-N-His)
PV285943 500 ng
EUR 603

NR2C1 Protein Vector (Rat) (pPM-C-HA)
PV285944 500 ng
EUR 603

NR2C1 Protein Vector (Rat) (pPM-C-His)
PV285945 500 ng
EUR 603

NR2C1 Protein Vector (Mouse) (pPB-C-His)
PV206522 500 ng
EUR 603

NR2C1 Protein Vector (Mouse) (pPB-N-His)
PV206523 500 ng
EUR 603

NR2C1 Protein Vector (Mouse) (pPM-C-HA)
PV206524 500 ng
EUR 603

NR2C1 Protein Vector (Mouse) (pPM-C-His)
PV206525 500 ng
EUR 603

NR2C1 Protein Vector (Human) (pPB-C-His)
PV028805 500 ng
EUR 329

NR2C1 Protein Vector (Human) (pPB-N-His)
PV028806 500 ng
EUR 329

NR2C1 Protein Vector (Human) (pPM-C-HA)
PV028807 500 ng
EUR 329

NR2C1 Protein Vector (Human) (pPM-C-His)
PV028808 500 ng
EUR 329

Nr2c1 3'UTR Luciferase Stable Cell Line
TU114293 1.0 ml Ask for price

Nr2c1 3'UTR GFP Stable Cell Line
TU164293 1.0 ml Ask for price

Nr2c1 3'UTR Luciferase Stable Cell Line
TU214163 1.0 ml Ask for price

Nr2c1 3'UTR GFP Stable Cell Line
TU264163 1.0 ml Ask for price

NR2C1 3'UTR GFP Stable Cell Line
TU065939 1.0 ml
EUR 1521

NR2C1 3'UTR Luciferase Stable Cell Line
TU015939 1.0 ml
EUR 1521

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody
20-abx006832
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2, Group C, Member 1 (NR2C1) Antibody
20-abx114195
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody
abx122665-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody
20-abx142106
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody
abx028626-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody
abx028626-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody
20-abx320065
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody
20-abx321546
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody
abx235840-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NR2C1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV666865 1.0 ug DNA
EUR 682

NR2C1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV666869 1.0 ug DNA
EUR 682

NR2C1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV666870 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

 

Scroll to Top