CDKN3 Rabbit Polyclonal Antibody

To Order:

CDKN3 Polyclonal Antibody

ABP53466-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse. This CDKN3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80

CDKN3 Polyclonal Antibody

ABP53466-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse. This CDKN3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80

CDKN3 Polyclonal Antibody

ABP53466-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse. This CDKN3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80

CDKN3 Polyclonal Antibody

ABP58093-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CDKN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse, Rat. This CDKN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDKN3 protein

CDKN3 Polyclonal Antibody

ABP58093-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CDKN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse, Rat. This CDKN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDKN3 protein

CDKN3 Polyclonal Antibody

ABP58093-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CDKN3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse, Rat. This CDKN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDKN3 protein

CDKN3 Polyclonal Antibody

ES8922-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CDKN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDKN3 Polyclonal Antibody

ES8922-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CDKN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDKN3 Polyclonal Antibody

ES4465-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CDKN3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CDKN3 Polyclonal Antibody

ES4465-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CDKN3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CDKN3 Rabbit pAb

A2061-100ul 100 ul
EUR 308

CDKN3 Rabbit pAb

A2061-200ul 200 ul
EUR 459

CDKN3 Rabbit pAb

A2061-20ul 20 ul
EUR 183

CDKN3 Rabbit pAb

A2061-50ul 50 ul
EUR 223

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit

DLR-CDKN3-Hu-48T 48T
EUR 517
  • Should the Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) in samples from tissue homogenates or other biological fluids.

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit

DLR-CDKN3-Hu-96T 96T
EUR 673
  • Should the Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) in samples from tissue homogenates or other biological fluids.

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit

RDR-CDKN3-Hu-48Tests 48 Tests
EUR 544

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit

RDR-CDKN3-Hu-96Tests 96 Tests
EUR 756

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit

RD-CDKN3-Hu-48Tests 48 Tests
EUR 521

Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit

RD-CDKN3-Hu-96Tests 96 Tests
EUR 723

CDKN3 antibody

70R-31929 100 ug
EUR 327
Description: Rabbit polyclonal CDKN3 antibody

CDKN3 Antibody

32578-100ul 100ul
EUR 252

CDKN3 antibody

10R-3660 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody

10R-3661 100 ul
EUR 726
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody

10R-3662 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody

10R-3663 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody

10R-3664 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody

10R-3665 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 antibody

10R-3666 100 ul
EUR 691
Description: Mouse monoclonal CDKN3 antibody

CDKN3 Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CDKN3 Antibody

CSB-PA005096KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CDKN3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

CDKN3 Antibody

DF6791 200ul
EUR 304
Description: CDKN3 Antibody detects endogenous levels of total CDKN3.

CDKN3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

CDKN3 antibody

70R-5506 50 ug
EUR 467
Description: Rabbit polyclonal CDKN3 antibody

CDKN3 Antibody

ABD6791 100 ug
EUR 438

Polyclonal Cdkn3 antibody - N-terminal region

APR01218G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cdkn3 - N-terminal region. This antibody is tested and proven to work in the following applications:

Anti-CDKN3 Antibody

A05157 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CDKN3 Antibody (CDKN3) detection.tested for WB in Human, Mouse.

CDKN3 Conjugated Antibody

C32578 100ul
EUR 397

Anti-CDKN3 antibody

STJ92208 200 µl
EUR 197
Description: Rabbit polyclonal to CDKN3.

Anti-CDKN3 antibody

STJ23083 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-CDKN3 antibody

STJ99640 200 µl
EUR 197
Description: Rabbit polyclonal to CDKN3.

Cdkn3/ Rat Cdkn3 ELISA Kit

ELI-10082r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA10887 50 ul
EUR 363
Description: Mouse polyclonal to CDKN3


YF-PA10888 50 ug
EUR 363
Description: Mouse polyclonal to CDKN3


YF-PA23429 50 ul
EUR 334
Description: Mouse polyclonal to CDKN3

CDKN3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDKN3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CDKN3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CDKN3 Blocking Peptide

33R-1720 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDKN3 antibody, catalog no. 70R-5506

CDKN3 Blocking Peptide

DF6791-BP 1mg
EUR 195

CDKN3 cloning plasmid

CSB-CL005096HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgaagccgcccagttcaatacaaacaagttgtaaatttaaagatgttagaagaaatgtccaaaaagatacagaagaactaaagagctgtggtatacaagacatatttgttttctgcaccagaggggaactgtcaaaatatagagtcccaaaccttctggatctctaccagcaatg
  • Show more
Description: A cloning plasmid for the CDKN3 gene.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3)

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with APC.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with Biotin.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with Cy3.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with FITC.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with HRP.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with PE.

CDKN3 protein (His tag)

80R-1586 100 ug
EUR 397
Description: Purified recombinant Human CDKN3 protein


EF006681 96 Tests
EUR 689

Rat CDKN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CDKN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


abx595870-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human CDKN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDKN3 Recombinant Protein (Human)

RP006694 100 ug Ask for price

CDKN3 Recombinant Protein (Rat)

RP194390 100 ug Ask for price

CDKN3 Recombinant Protein (Mouse)

RP123212 100 ug Ask for price

Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) ELISA kit

E04C1578-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) ELISA kit

E04C1578-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) ELISA kit

E04C1578-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit

abx363507-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDKN3 (Met1~Arg212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with APC-Cy7.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody

abx117191-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody

abx033454-400ul 400 ul
EUR 551
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody

abx033454-80l 80 µl
EUR 321
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

CDKN3 Colorimetric Cell-Based ELISA

EKC1837 100ul
EUR 572

Cdkn3 ORF Vector (Rat) (pORF)

ORF064798 1.0 ug DNA
EUR 506

CDKN3 ORF Vector (Human) (pORF)

ORF002232 1.0 ug DNA
EUR 95

Cdkn3 ORF Vector (Mouse) (pORF)

ORF041072 1.0 ug DNA
EUR 506

CDKN3 ELISA Kit (Human) (OKCD01665)

OKCD01665 96 Wells
EUR 831
Description: Description of target: May play a role in cell cycle regulation. Dual specificity phosphatase active toward substrates containing either phosphotyrosine or phosphoserine residues. Dephosphorylates CDK2 at 'Thr-160' in a cyclin-dependent manner.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CDKN3 sgRNA CRISPR Lentivector set (Human)

K0420501 3 x 1.0 ug
EUR 339

Cdkn3 sgRNA CRISPR Lentivector set (Rat)

K6267201 3 x 1.0 ug
EUR 339

Cdkn3 sgRNA CRISPR Lentivector set (Mouse)

K3512801 3 x 1.0 ug
EUR 339

Human Cyclin-dependent kinase inhibitor 3 (CDKN3)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 25.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cyclin-dependent kinase inhibitor 3(CDKN3) expressed in Yeast

CDKN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0420502 1.0 ug DNA
EUR 154

CDKN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0420503 1.0 ug DNA
EUR 154

CDKN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0420504 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6267202 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6267203 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6267204 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3512802 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3512803 1.0 ug DNA
EUR 154

Cdkn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3512804 1.0 ug DNA
EUR 154

CDKN3 Protein Vector (Mouse) (pPB-C-His)

PV164286 500 ng
EUR 603

CDKN3 Protein Vector (Mouse) (pPB-N-His)

PV164287 500 ng
EUR 603

CDKN3 Protein Vector (Mouse) (pPM-C-HA)

PV164288 500 ng
EUR 603

CDKN3 Protein Vector (Mouse) (pPM-C-His)

PV164289 500 ng
EUR 603

CDKN3 Protein Vector (Rat) (pPB-C-His)

PV259190 500 ng
EUR 603

CDKN3 Protein Vector (Rat) (pPB-N-His)

PV259191 500 ng
EUR 603

CDKN3 Protein Vector (Rat) (pPM-C-HA)

PV259192 500 ng
EUR 603

CDKN3 Protein Vector (Rat) (pPM-C-His)

PV259193 500 ng
EUR 603

Recombinant Cyclin Dependent Kinase Inhibitor 3 (CDKN3)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16667
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Cyclin Dependent Kinase Inhibitor 3 expressed in: E.coli

CDKN3 Protein Vector (Human) (pPB-C-His)

PV008925 500 ng
EUR 329

CDKN3 Protein Vector (Human) (pPB-N-His)

PV008926 500 ng
EUR 329

CDKN3 Protein Vector (Human) (pPM-C-HA)

PV008927 500 ng
EUR 329

CDKN3 Protein Vector (Human) (pPM-C-His)

PV008928 500 ng
EUR 329

Recombinant Human CDKN3 Protein, His, E.coli-1mg

QP11379-1mg 1mg
EUR 3655

Recombinant Human CDKN3 Protein, His, E.coli-20ug

QP11379-20ug 20ug
EUR 201

Recombinant Human CDKN3 Protein, His, E.coli-5ug

QP11379-5ug 5ug
EUR 155

Cdkn3 3'UTR GFP Stable Cell Line

TU153656 1.0 ml Ask for price

Cdkn3 3'UTR Luciferase Stable Cell Line

TU103656 1.0 ml Ask for price

Cdkn3 3'UTR Luciferase Stable Cell Line

TU202122 1.0 ml Ask for price

Cdkn3 3'UTR GFP Stable Cell Line

TU252122 1.0 ml Ask for price

CDKN3 3'UTR GFP Stable Cell Line

TU054094 1.0 ml
EUR 1394

CDKN3 3'UTR Luciferase Stable Cell Line

TU004094 1.0 ml
EUR 1394

CDKN3 Colorimetric Cell-Based ELISA Kit (OKAG01360)

OKAG01360 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM


Scroll to Top