COL19A1 Rabbit Polyclonal Antibody

To Order:  patrick@cotinis.com

COL19A1 Polyclonal Antibody
ABP58227-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210

COL19A1 Polyclonal Antibody
ABP58227-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210

COL19A1 Polyclonal Antibody
ABP53760-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470

COL19A1 Polyclonal Antibody
ABP53760-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470

COL19A1 Polyclonal Antibody
ABP53760-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470

COL19A1 Polyclonal Antibody
46906-100ul 100ul
EUR 252

COL19A1 Polyclonal Antibody
46906-50ul 50ul
EUR 187

COL19A1 Polyclonal Conjugated Antibody
C46906 100ul
EUR 397

COL19A1 Antibody
AF9044 200ul
EUR 304
Description: COL19A1 Antibody detects endogenous levels of total COL19A1.

COL19A1 Antibody
ABF9044 100 ug
EUR 438

COL19A1 Antibody
44308-100ul 100ul
EUR 252

COL19A1 Antibody
44308-50ul 50ul
EUR 187

COL19A1 Antibody
1-CSB-PA007137
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

COL19A1 Antibody
1-CSB-PA325870
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

COL19A1 Antibody
CSB-PA213241-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

COL19A1 Antibody
CSB-PA213241-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

COL19A1 Conjugated Antibody
C44308 100ul
EUR 397

Anti-COL19A1 antibody
STJ92382 200 µl
EUR 197
Description: Rabbit polyclonal to COL19A1.

Anti-COL19A1 antibody
STJ99329 200 µl
EUR 197
Description: Rabbit polyclonal to COL19A1.

COL19A1 siRNA
20-abx912404
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COL19A1 siRNA
20-abx912405
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-COL19A1
YF-PA23489 50 ul
EUR 334
Description: Mouse polyclonal to COL19A1

COL19A1 Blocking Peptide
AF9044-BP 1mg
EUR 195

COL19A1 cloning plasmid
CSB-CL614819HU-10ug 10ug
EUR 1252
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3429
  • Sequence: ATGAGACTCACTGGCCCTTGGAAACTTTGGCTTTGGATGTCAATATTTCTGCTTCCTGCTTCCACTTCCGTGACCGTTAGGGACAAGACAGAAGAGTCATGCCCTATCCTGAGAATAGAGGGACATCAGCTGACATATGACAACATAAACAAACTTGAAGTTTCAGGTTTTGATC
  • Show more
Description: A cloning plasmid for the COL19A1 gene.

COL19A1 Blocking Peptide
20-abx061072
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human COL19A1 shRNA Plasmid
20-abx950922
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse COL19A1 shRNA Plasmid
20-abx969753
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rabbit Collagen Alpha 1(XIX) chian (COL19A1) ELISA kit
E04C1898-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 1(XIX) chian (COL19A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen Alpha 1(XIX) chian (COL19A1) ELISA kit
E04C1898-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 1(XIX) chian (COL19A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen Alpha 1(XIX) chian (COL19A1) ELISA kit
E04C1898-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 1(XIX) chian (COL19A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
20-abx149451
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
20-abx133490
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
abx030632-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
abx030632-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Collagen Alpha-1(XIX) Chain (COL19A1) Antibody
20-abx013964
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Col19a1 ORF Vector (Mouse) (pORF)
ORF041763 1.0 ug DNA
EUR 506

COL19A1 ORF Vector (Human) (pORF)
ORF012738 1.0 ug DNA
EUR 354

Collagen Type XIX Alpha 1 Chain (COL19A1) Antibody
20-abx324795
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Collagen Type XIX Alpha 1 Chain (COL19A1) Antibody
20-abx324993
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Collagen Type XIX Alpha 1 Chain (COL19A1) Antibody
abx330322-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

COL19A1 sgRNA CRISPR Lentivector set (Human)
K0485401 3 x 1.0 ug
EUR 339

Col19a1 sgRNA CRISPR Lentivector set (Mouse)
K3650901 3 x 1.0 ug
EUR 339

COL19A1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0485402 1.0 ug DNA
EUR 154

COL19A1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0485403 1.0 ug DNA
EUR 154

COL19A1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0485404 1.0 ug DNA
EUR 154

Col19a1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3650902 1.0 ug DNA
EUR 154

Col19a1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3650903 1.0 ug DNA
EUR 154

Col19a1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3650904 1.0 ug DNA
EUR 154

COL19A1 Protein Vector (Human) (pPB-C-His)
PV050949 500 ng
EUR 481

COL19A1 Protein Vector (Human) (pPB-N-His)
PV050950 500 ng
EUR 481

COL19A1 Protein Vector (Human) (pPM-C-HA)
PV050951 500 ng
EUR 481

COL19A1 Protein Vector (Human) (pPM-C-His)
PV050952 500 ng
EUR 481

COL19A1 Protein Vector (Mouse) (pPB-C-His)
PV167050 500 ng
EUR 1065

COL19A1 Protein Vector (Mouse) (pPB-N-His)
PV167051 500 ng
EUR 1065

COL19A1 Protein Vector (Mouse) (pPM-C-HA)
PV167052 500 ng
EUR 1065

COL19A1 Protein Vector (Mouse) (pPM-C-His)
PV167053 500 ng
EUR 1065

Col19a1 3'UTR Luciferase Stable Cell Line
TU202611 1.0 ml Ask for price

Col19a1 3'UTR GFP Stable Cell Line
TU154169 1.0 ml Ask for price

COL19A1 3'UTR Luciferase Stable Cell Line
TU004792 1.0 ml
EUR 1521

Col19a1 3'UTR Luciferase Stable Cell Line
TU104169 1.0 ml Ask for price

COL19A1 3'UTR GFP Stable Cell Line
TU054792 1.0 ml
EUR 1521

Col19a1 3'UTR GFP Stable Cell Line
TU252611 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

 

Scroll to Top